Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 70 (1)  March 2015 7 Translocation of Rabies Virus by Cattle
INTRODUCTION
Rabies virus is a member of the Rhabdoviridae, genus
Lyssavirus. All mammals are susceptible to rabies infection.
Rabies is enzootic throughout the Middle East, including
Israel. Rabies is also a serious enzootic disease in Jordan,
Syria, Lebanon and Iran and Irak where stray dogs maintain
rabies virus in circulation, with frequent spillover to wildlife,
including jackals, squirrels, stone-martens, foxes, wolves and
infection of domestic animals and human (1, 2, 3, 4, 5, 6).
Since 1979, red foxes (Vulpes vulpes) have become the
most important reservoir of rabies virus in Israel (7). An
oral vaccination (ORV) program directed at wild animals
has been implemented since 1998 in northern Israel (8). In
2004 the program was extended and it currently covers all the
territories controlled by Israel and the Palestinian Authority.
Israel is the only country in the Middle East that imple-
ments ORV program. To insure its success, extensive rabies
surveillance along Israel’s borders is carried out. Despite the
efcacy of the ORV in controlling fox rabies in north Israel, a
new outbreak occurred in 2004 in this region, in which stray
dogs (Canis familiaris) where shown to be main reservoir and
transmitter of genetic variant V7 (9, 10).
Molecular epidemiological studies of rabies in Israel be-
tween 1993 and 1998 revealed four fox strain genetic lineages
(V1-V4), were distributed within four geographical regions
(11). Molecular analysis of rabies isolates on the borders of
Israel and neighboring countries revealed the presence of
three genetic variants V5, V6 and V7 (12). Due to the ORV
program, fox rabies genetic variants V1 and V2 specifc to
northern Israel region were eliminated in 2003, while fox
strain genetic variants V3 and V4 enzootic to central and
southern of Israel were eliminated by 2005 (9).
However, incursions of fox rabies variant infected ani-
mals persisted across Israel’s borders. Between 2002 to 2013
about 32 isolates of fox rabies virus belonging to the genetic
variant V1, were detected within Israel and its neighboring
countries.
All mammals are susceptible to rabies virus. Bovine rabies
has a direct economic impact (13) on the livestock industry
and represents a public health threat in rabies endemic area.
In Israel between the years 1996-2014, 104 rabies cases
were reported in cattle, most of them on the borders with
neighboring countries.
Recently two human rabies mortalities, one in Iran and
Translocation of Rabies Virus in Israel by Cattle:
A Treat for the Public Health
David, D.,* Dveres, N., Yakobson, B.A. and Davidson, I.
Kimron Veterinary Institute, Bet Dagan 50250, POB 12, Israel.
*
Corresponding Author: Dr. D. David, Tel :+972-506241984, Fax: +972-3-9681721. Email: davidd@int.gov.il
ABSTRACT
Rabies is endemic in Israel, the only country in the Middle East that implements a nation-wide anti-rabies
campaign. However, between 2002 and 2013 about 32 rabies virus isolates belonging to genetic variant V1
were recovered within Israel. Te present study describes for the frst time the translocation of the rabies
virus strain, fox V1, by infected cattle born on “Tzfon HaGolan dairy farm” located in Kibbutz Ortal on the
Golan Heights to two farms situated in the western Yezre’el Valley, emphasizing that cattle may serve also
a source of human rabies infection.
Keywords: Rabies; Cattle; Translocation; Diagnosis; Post exposure vaccination.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (1)  March 2015 David, D. 8
the second in Brazil were reported from human handling ra-
bies infected livestock (14, 15). Te two veterinarians involved
were not vaccinated against rabies and did not received post
exposure prophylaxis.
Tere are several examples of long distance transmis-
sion translocation of rabies virus by human mediated ani-
mal movements and trade. Recently there was a number of
reported translocations of infected bovine from Romania
to Croatia (16), and in Ohio, USA (17). Translocation of
dog rabies from northern Israel to Jerusalem (18) and to the
center of the country was also reported (19).
In the present report, we describe for the frst time rabies
translocation by infected cattle from a dairy herd on the
Golan Heights to two farms located in the western part of
the Yezre’el Valley, as well as a rabies infected case in cattle
in Israel. In addition to the economic damage caused to the
dairy industry by rabies infection, the zoonotic aspects are
discussed.
CASE REPORT
On September 29, 2013, two 11 weeks old calves one from a
village Bet Zaid and the other form a village, Kfar Yehushua
in the western Yezre’el valley showed clinical signs of change
in behavior, salivation, difculty in swallowing, vocalization
and recumbence. Rabies was suspected and the two calves
were diagnosed rabies positive by direct immunofuorescence
assay (DFA) on the brain tissue, at the Israeli National Rabies
Laboratory, Kimron Veterinary Institute (KVI), Bet Dagan,
Israel.
In addition on November 1
st
2013, two more calves, one
8 months old, from Kibbutz Ortal, and the second from Kfar
Yehushua were rabies positive by DFA (Fig. 1).
A case investigation revealed that on August 26, a Jackal
had entered an orchard near the Kibbutz Ortal it was shot
and the carcass sent to National Rabies Laboratory (20).
Te Ortal dairy farm is one of the largest and most modern
in Israel. Male calves are sold at a few weeks of age to other
Figure 1: Succession of events following entry of a rabid jackal into Kibbutz Ortal dairy farm.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (1)  March 2015 9 Translocation of Rabies Virus by Cattle
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus TAAAGGCTGGTCATCCTTTTGACGCTTCAAGTCCTGAAGATCGCCTCCCCTTGGGGTTGG
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus TAAAGGCTGGTCATCCTTTTGACGCTTCAAGTCCTGAAGATCGCCTCCCCTTGGGGTTGG
70 80 90 100 110 120
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus GTAGAATCTCTGGGTTCAATAGTCCTCCTTGAACTCCATGCAACAGGGTAGATTCAAGAG
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus GTAGAATCTCTGGGTTCAATAGTCCTCCTTGAACTCCATGCAACAGGGTAGATTCAAGAG
130 140 150 160 170 180
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus TCATGAGATTTTCATTAATCATCTCAGTTGATCAAACTAGATCATGTAGATTCTCATAAT
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus TCATGAGATTTTCATTAATCATCTCAGTTGATCAAACTAGATCATGTAGATTCTCATAAT
190 200 210 220 230 240
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus ACGGGAAATCTTCTAGCAGTTTCAGTGACCAACGGTGCTTTCATTCTCCAGGAACTGGTA
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus ACGGGAAATCTTCTAGCAGTTTCAGTGACCAACGGTGCTTTCATTCTCCAGGAACTGGTA
250 260 270 280 290 300
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus CCAAAGGCTGTGGACGGGTCGAGAGGTGTTTCGGATGACTCCGTACTAGGGCACGGACAG
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus CCAAAGGCTGTGGACGGGTCGAGAGGTGTTTCGGATGACTCCGTACTAGGGCACGGACAG
310 320 330 340 350 360
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus AGGTCATGGTGCGTCCCATGATAGCAAACTCAGCATGAGTTTATTGAGAAAGGCAATTTG
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus AGGTCATGGTGCGTCCCATGATAGCAAACTCAGCATGAGTTTATTGAGAAAGGCAATTTG
370 380 390 400 410 420
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus CCTCCCATGAGGGACATAAGCAATAGATCATGATCATCTCGCATTTCAGCAAAGTGTGCA
780/2013/Jackal/OR7353/ORTAL ............................................................
783/Cattle/2013/Bet Zaid ............................................................
786/cattle/2013/Kfar Yehosua ............................................................
787/Cattle/2013/Ortal ............................................................
784/cattle/2013/Kfar Yehosua ............................................................
Consensus CCTCCCATGAGGGACATAAGCAATAGATCATGATCATCTCGCATTTCAGCAAAGTGTGCA
430 440 450 460 470 480
----:----|----:----|----:----|----:----|----:----|----:----|
Consensus CAATTATAAAGGGCTGGGTCATCTAAGCTTTTCAGTCGAGAAAAAAACT
780/2013/Jackal/OR7353/ORTAL .................................................
783/Cattle/2013/Bet Zaid .................................................
786/cattle/2013/Kfar Yehosua .................................................
787/Cattle/2013/Ortal .................................................
784/cattle/2013/Kfar Yehosua .................................................
Consensus CAATTATAAAGGGCTGGGTCATCTAAGCTTTTCAGTCGAGAAAAAAACT
Figure 2: Comparison of 469 base pairs of the G-L intergenic fragments from the sequences of
the four calves and the Jackal isolates.
locations throughout Israel for fattening.
A group of 54 rabies unvaccinated calves
was transported form Kibbutz Ortal on
September 10, 2013 to a cattle holding
farm in Bet Zaid and then distributed to
several farms in Kfar Yehushua.
Four calves and the jackal were diag-
nosed rabies positive by DFA. Diagnosis
was confrmed by virus isolation in tissue
culture, and its inoculation into suckling
mice (21). Reverse transcriptase – PCR
and direct sequencing were applied to a
469 base-pair (bp) G-L intergenic region
fragment (19). A phylogenetic tree was
constructed by the neighbor–joining
method, with the distance calculated
using the Kimura-2 parameter with the
computer program MEGA, version 4.1
(22). Te reliability of the phylogenetic
groupings was evaluated using bootstrap-
ping with 1000 replicates.
Te molecular analysis showed that
the viral sequence obtained from the 4
calves and the Jackal belonged to the V1
genetic variant (Fig.2). Following the
diagnosis of rabies, post-exposure vacci-
nation was administered to a group of 12
people, who had come into contact with
the three calves and the jackal (Fig. 3).
DISCUSSION
Rabies is endemic in Israel and since
2004 stray dogs were found to be the
main reservoir and transmitter (7, 10).
However the ORV program of wildlife
eliminated the fox rabies variants V1 to
V4 from almost all rural areas in Israel.
Nevertheless, there is still incursion of
fox genetic variants V1 across the borders
with neighboring countries. Te genetic
variant V1 caused mortality of 11 cattle,
2 sheep and 2 horses during the last 12
year on the border but was never detected
in the Yezre’el valley region (Fig. 3).
Based on molecular and epidemio-
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (1)  March 2015 David, D. 10
logical analysis the 4 calves reported here were most likely
bitten by the rabid Jackal. We therefore assumed that the
calves were infected by the rabid jackal that had entered
Kibbutz Ortal. Tis notion is supported by the chain of events
described above and the identical molecular fndings in the
infected calves and Jackal.
Te incubation period of rabies virus in cattle varies from
20 to 165 days (23). In our case the period of incubation was
between 1 to 3.5 months. Various sanitary measures were
implemented in Ortal and two farms in Emek Yezre’el as a
result of this case: quarantine of cattle at the Ortal dairy farm
and quarantine and vaccination of all the calves at the two
farms in Emek Yezre’el.
Vaccination of cattle is not mandatory in Israel however,
this case illustrates the importance of the current recommen-
dation of the Israeli Veterinary Services and Animal Health
to vaccinate cattle in rabies areas, where a high risk exists of
rabies-infected wildlife penetrating its borders.
ACKNOWLEDGEMENTS
Te authors thank the veterinary ofcer of Afula district, for his
help. Te authors are indebted Dr. Abed Hamaysi the for providing
information about the cases.
REFERENCES
1. Horton, D.L., Ismail, M. Z., Siryan, E.S., Wali A.R.A., Ab-Dulla
H.E., Wise E., Voller K., Harkess, G., Marston, D.A., McElhin-
ney, L.M., Abbas, S.F. and Fooks, A.R. Rabies in Iraq: Trend in
human cases 2001-2010 and characterization of animal rabies
strains from Bagdad. PLOS Neg. Trop. Dis. 7:e2075, 2013.
2. Johnson, N., Black, C., Smith J., Un, H, McElhinney, L.M., Aylan,
O. and Fooks, A. R.: Rabies emergence among foxes in Turkey J.
Wildl. Dis. 2003: 39: 262–270, 2003.
3. Al-Qudah, K.M., Al-Rawashdeh, O.F., Abdul-Majeed, M. and
Al-Ani, F.K.: An epidemiological investigation of rabies in Jordan.
Acta. Vet. (Beogr) 47: 129–134, 1997.
4. Bizri, A.R., Alawieh, A., Ghason, N. and Musharrafeh, U. Chal-
lenge facing human rabies control: Te Lebanese experience.
Epidemiol. Infect. 125: 1–9, 2013.
5. Nadin-Davis, S.A., Simani, S., Amstrong, J., Fayaz, A. and Wande-
ler, A.I.: Molecular and antigenic characterization of rabies viruses
from Iran identifes variants with distinct epidemiological origins.
Epidemiol. Infect 131:777-790, 2003.
6. Faizee, M., Hailat N.Q., Ababneh, M.M., Hananeh W.M. and
Muhaidat, A. Pathological, immunological and molecular diag-
nosis of rabies in clinically suspected animals of diferent species
using four detection technique in Jordan. Transbound. Emerg.
Dis. 59:154-164, 2012.
7. Shimshony, A. Epidemiology of emerging zoonoses in Israel.
Emerg Infect Dis. 3, 229-238. 1997.
8. Yakobson, B.A., King, R.J., Amir, S., Dveres, N., Sheichat, N.,
Rotenberg, D., Mildenberg, Z., and David, D. (2005). Rabies vac-
cination programme for red fox (Vulpes vulpes) and Golden Jackals
(Canis aureus) in Israel (1999-2004). Dev Biol. 125,133-140.
9. David, D., Dveres, N., Yakobson, B.A. and Davidson, I.: Emer-
gence of dog rabies in the northern region of Israel. Epidemiol.
Infect. 137:544-548, 2009.
10. David, D. and Yakobson B. A.: Dogs serve as reservoir and trans-
mit rabies in Israel. Is history repeating itself ? Isr. J. Vet. Med.
66:3-8. Review, 2011.
11. David, D., Hughes, G.J, Yakobson, B.A., Davidson, I., Hu, N.H.,
Ayalon, O., Kuzmin, I.V. and Rupprecht, C.E.: Identifcation of
novel canine rabies virus clades in the Middle East and North
Africa. J. Gen. Virol. 88: 967-98, 2007.
Figure 3: Map of Israel showing the area of northern Israel where 32
rabies virus belonging to the VI genetic variants were isolated during
2002 through 2012 on the borders with neighbors countries; the three
positive calves isolated in Emek Yezre’el the Jackal and the fourth calf
in Kibbutz Ortal.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (1)  March 2015 11 Translocation of Rabies Virus by Cattle
12. David, D., Yakobson, B.A., Smith, J.S. and Stram, Y.: Molecular
epidemiology of rabies virus isolates from Israel and other Middle
and Near Eastern countries. J. Clin. Microbiol. 38, 755-762. 2000.
13. Vos, A., Un, H., Hampson, K., De Balogh, K., Aylan, O., Freul-
ing, C.M., Muller, T., Fooks, A.R. and Johnson, N.: Bovine rabies
in Turkey: patterns of infection and implications for costs and
control. Epidemiol. Infect. 2013.
14. Simani, S., Fayaz, A., Rahimi, P., Eslami, N., Howeizi, N. and
Biglari, P.: Six fatal cases of classical rabies virus without biting
incidents, Iran 1990-2010. J. Clin. Virol. 54:251-254, 2012.
15. Brito, M.G., Chamone, T.L., Silva, F.J., Wada, M. Y., Miranda,
A.L., Castilho, J.G., Carrieri, M.L., Kotait, I. and Lemos, F.L.:
Antemortem diagnosis of human rabies in a veterinarian infected
when handling a herbivore in Minas Gerais, Brazil. Rev. Inst. Med.
Trop. Sao Paulo, 53:39-44, 2011.
16. Lojki, I., Bedekovic, T., Cac, Z., Lemo N. and Cvetnic, Z.: Clinical
rabies in cattle imported into Croatia. Vet. Rec. 172: 22-23, 2013.
17. Chipman, R.B., Cozzens, T.M., Swif, S.A., Biswas, R., Plumely,
J., O’Quin, J., Algeo, T.P., Rupprecht, C.E. and Slate, D.: Costs
of raccoon rabies incidents in cattle herds in Hampshire county,
west Virginia, and Guernsey County, Ohaio. JAVMA 243:1561-
1567, 2013.
18. David, D., Dveres, N., Davidson, I., Yagil, J., Dvorkin, Z. and
Oved, Z.: Geographic Translocation of Dog Rabies by Tourism.
Israel. J. Vet. Med. 67: 139-142. 2012.
19. David, D., Yakobson, B.A., Gershkovich, L. and Gayer, S.: Tracing
the movement of an Israeli dog by viral analysis. Vet. Rec. 155:
496-497, 2004.
20. ProMed, 2013. Rabies Animal – Israel (03): North bovine, Jackal,
human exposure. Archive Number: 20131002.1980716. 3 October
2013.
21. David, D., Yakobson, B.A., Rotenberg, D., Dveres, N., Davidson,
I. and Stram, Y.: Rabies virus detection by RT-PC R in decom-
posed naturally infected brains. Vet. Microbiol. 87: 111-118, 2002.
22. Kumar, S., Tamura, K. and Nei, M.: Integrated Software for
molecular evolutionary genetics analysis and sequence alignment
briefngs in Bioinformatics 5, 150-163, 2004.
23. Hudson, L.C., Weinstock , D., Jordan, T. and Bold-Fletcher, N.O.:
Clinical feature of experimentally induced rabies in cattle and
sheep. J. Vet. Med. 43:85-95, 1996.
Research Articles