Embedded Scribd iPaper - Requires Javascript and Flash Player
Methylase Genes-Mediated Erythromycin Resistance in Staphylococcus aureus from Bovine Mastitis in China
College of Life Science and Technology, HeiLongJiang BaYi Agricultural University, Daqing 163319, PR China. College of Animal Science and Veterinary Medicine, HeiLongJiang BaYi Agricultural University, Daqing 163319, PR China. # Both authors contributed equally to this work.
1 2
Ding, Z.F.,1# Zhang, H.,1 # Tang, W.,1 Tong, C.Y.,1 Li, R.T.,1 Chen, L.X.,1 Pu, L.J.,1 Zhu, Z.B.2 and Cui, Y.D.1,2*
* Corresponding author: Cui, Y.D, College of Bioscience and Technology, HeiLongJiang BaYi Agricultural University, 1 Xinyang road, Daqing 163319, PR China. E-mail: cuiyudong@yahoo.com, tel.: +86 459 681 9290; fax: +86 459 681 9290.
Erythromycin is commonly used to treat bovine mastitis caused by Staphylococcus aureus (S. aureus), which has resulted in a high-level of resistance in China. In this study, we investigated erythromycin-resistant phenotypes and relevant resistant genes among 26 S. aureus isolates from bovine mastitis in China. Twenty (76.9%) of erythromycin-resistant isolates were identified (MIC values ≥ 64 µg/mL). Resistance phenotype analysis determined 15 (57.7%) inducible-macrolide, lincosamide, and streptogramin B (iMLSB) and 5 (19.2%) constitutive macrolide, lincosamide, and streptogramin B (cMLSB) phenotypes, respectively. PCR detection of efflux genes (mefA and msrA) and methylase genes (ermA, ermB and ermC) confirmed that none of mefA, msrA, and ermA genes, which were demonstrated exhibiting the efflux mechanism existed in the resistant isolates. However, ermB genes were determined in 100% (26/26) and ermC genes were detected in 84.6% (22/26). These findings suggested that erythromycin-resistance was caused mainly by methylase encoded by ermB and ermC genes. Interestingly, 6 erythromycin-susceptible isolates were presented in ermBcarrying isolates, and 2 were detected in both ermB- and ermC-carrying isolates. Further sequence analysis of the ermB, ermC and 23S-rRNA genes revealed that erythromycin-susceptibility might be engendered by mutations of 23S-rRNA resulting in an inability for methylation. These data adequately illustrated that ribosome methylases encoded by ermB and ermC genes has played a vital role in the resistance of S. aureus in bovine mastitis in China. Keywords: Staphylococcus aureus, efflux mechanism, erythromycin resistance, methylase genes.
AB S T RAC T
Mastitis, an important disease of diary cows, occurs widely and can be caused by infections with bacteria, yeast or fungi (1,2). A recent investigation showed that Staphylococcus aureus (S. aureus) represented a greater proportion of the isolated pathogenic bacteria in cases of clinical mastitis (3). Erythromycin, a macrolide antibiotic, is effective against a variety of gram positive bacteria and commonly used to treat
INTRODUCTION
bovine mastitis (3,4). As a result of widespread utilization of erythromycin, the resistance level of S. aureus has been increasing rapidly. Therefore an investigation into the erythromycin-resistance of S. aureus has become imperative (5). Previous studies have reported that the majority of resistance to erythromycin from different cases of bovine mastitis may be due to different mechanisms: drug inactivation (6), loss of permeability (7), an active efflux mechanism (8) or tarIsrael Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
170
Ding, Z.
Original Articles
get region modification by methylation or mutation (9). One of the important active efflux mechanisms may be based on the membrane-bound efflux protein encoded by mef A gene (10). Another is involved in marcolides-streptogramins resistance gene A (msrA) which emerged in clinical strains of S. aureus since the 1980’s (11). msrA gene encodes macrolide efflux pump which is frequently detected in S. aureus, belongs to the ABC transporter family, and induces resistance to 14and 15-membered macrolides (M phenotype) and streptogramins B only (12). The structural changes in ribosomal RNA (rRNA) that prevent the binding of macrolides are another important resistance mechanism conferring high-level resistance. (13). S. aureus is able to synthesize such kind of enzyme: ribosome methylases, which are encoded by one or more erythromycin-resistant methylase genes (erm). After the methylation of 23S-rRNA, the binding site for macrolide-lincosamidestreptogramin B (MLSB) antibiotics is altered. erm genes often confer constitutive resistance to macrolides-lincosamides-streptogramin B phenotype (cMLSB), but also may encode inducible resistance phenotype (iMLSB) (14). The main methylase genes that have been identified in S. aureus are ermA, ermB and ermC (9). Production of methylase results in the N6-dimethylation of adenine residue at position 2058 of 23S-rRNA. The conformational changes which occur in the P site of 23S-rRNA prevent macrolide binding, thus the inhibitory effect of the macrolide on protein synthesis is overcome (15). Wang et al. (16) reported that the prevalence of S. aureus exceed more than 25.2% of cases. However, there have been few studies to identify the macrolide-resistant genes in S. aureus isolated from bovine mastitis in China. The data regarding the investigation of the cMLSB phenotype and iMLSB phenotype has been very limited (2). Methylase genes-mediated resistance to erythromycin in S. aureus requires elucidating. Moreover, whether the mutation of 23S-rRNA in S. aureus would alter the susceptibility to erythromycin remains elusive (17). In this study, 20 cases of erythromycin resistance in 26 clinical S. aureus isolates were determined. We further detected the presence of two important efflux genes (mefA and msrA) and three macrolide-resistant genes (ermA, ermB and ermC), as well as the influence of mutation in 23S-rRNA on the resistant isolates. This comprehensive understanding about the erythromycin-resistant mechanism could provide
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
clues for developing new strategies to treat clinical bovine mastitis caused by S. aureus in China. MATERIALS AND METHODS
Bacterial strains and standard strains
During 2008-2010, 150 milk samples from 12 diary farms were collected form clinical bovine mastitis cases in the provinces of Hebei, Hubei, and Heilongjiang, Tianjin Municipality, and Inner Mongolia autonomous region of China based on one isolates per herd. A total of 26 isolates were identified as S. aureus by conventional microbiological methods including gram stain, colony morphology, and coagulase testing with rabbit plasma, as well as species-specific and the ubiquitous DNA-based assay reported by Martineau et al. (18). The confirmed S. aureus isolates were stored at -20oC. The standard Staphylococcal strains (ATCC25923 and ATCC29213) were purchased form Tianhe Biological Products Co. Ltd, Hangzhou, China. According to the guidelines of the clinical and laboratory standards institute (19), Kirby-Bauer antibiotic testing method (K-B testing) was performed for evaluating susceptibility of S. aureus to erythromycin. S. aureus was streak inoculated onto the solidified Mueller-Hinton (M-H) agar media (Hope Bio-Technology, Qingdao, China) and cultured at 37oC for 18-24 h. Then single colonies were inoculated into M-H broth cultural media for 4 h at 35oC. S. aureus suspension (optical density at 600 nm wavelength (OD600) arriving at 0.1) was diluted serially tenfold. The bacterial suspension (0.5 mL) was seeded onto a 90-mm-diameter solidified M-H agar media, and antimicrobial susceptibility test discs (Tianhe microorganism, Hangzhou, China) were placed onto the agar media. These dishes were incubated for 16-18 h at 35oC, followed by determination of susceptibility through measuring the diameter of inhibitory zone for bacterial growth around the test discs. The S. aureus was interpreted as sensitive (S), intermediate (I), and resistant (R) when the inhibitory diameter were ≥ 23 mm, 14-23 mm, and ≤ 14 mm, respectively (20). Each strain was repeated three times and a control test was performed with the standard strain (ATCC25923). At the same time, in light of the above method, the broth dilution method (serial double dilution) (19) was performed in order determine the minimal inhibitory concentration (MIC) of
Methylase Genes-Mediated Erythromycin Resistance
Testing erythromycin susceptibility of S. aureus
171
Original Articles
erythromycin for the resistant isolates and standard strain (ATCC29213) which was used as the control strain.
Genes msrA
Table 1: Primers used to detect the erythromycin-resistant genes. Primer
Determining the bacterial active efflux mechanism
In the process to determine the MIC values, the broth cultural media containing 20 µg/mL efflux inhibitor Reserpine (Tianhe, Hangzhou, China) was prepared to estimate the effects of efflux inhibitor on the erythromycin resistance. The tested bacterium was interpreted as exhibiting the active efflux mechanism when the MIC value in broth cultural media containing reserpine and erythromycin was four times lower than the MIC value containing only erythromycin (21).
F: 5'-CGATGAAGGAGGATTAAAATG-3' R: 5'-CATGAATAGATTGTCCTGTTAATT-3' mefA F: 5'- AGTATCATTAATCACTAGTGC -3' R:5'-TTCTTCTGGTACAAAAGTGG-3' ermA F: 5'-ATGAACCAGAAAAACCCTAAA-3' R:5'-GGCTTAGTGAAACAATTTGTAAC-3' ermB F: 5'-GGCGGATGAACAAAAATATAAAATA-3' R:5'-GCGTTATTTCCTCCCGTTAAA-3' ermC F: 5'-GGCATGAACGAGAAAAATATAAA-3' R:5'-GCGGGTTACTTATTAAATAATTT-3' 23S-rDNA F: 5'-GGTGAGCTCGATTAAGTTATTAAGGG-3' R:5'- CTCGTCGACTAACCTCATCATCTTTG-3' ermB P F: 5'-GGGGATCCTGTATAATAGGAATTGA-3' R:5'-GTACTCGAGTTATTTCCTCCCGTT-3' ermC P F: 5'-GCGGGATCCTGTTCATATTTATC-3' R:5'-GGGGGCTCGAGTTACTTATTAAATA-3'
PCR product size 1733 bp 367 bp 732 bp 738 bp 735 bp 2854 bp 1011 bp 913 bp
Analyzing the resistant phenotypes
A double-disc agar diffusion test (D-test) (22) was performed to determine the resistance phenotype of erythromycin-resistant isolates. After fresh growing bacteria were inoculated onto M-H agar plates, erythromycin (15 µg) and clindamycin (2 µg),( Tianhe, Hangzhou, China) discs were placed 15 mm apart on the plates and incubated for 18 to 24 h at 35°C. Resistance to erythromycin and a “D”-shaped zone around the clindamycin disc was defined as iMLSB phenotype. Resistance to both antibiotics was defined as the cMLSB phenotype (4). To begin with, the proteinase (K) method (8) was applied for extracting bacterial genomic DNA. In brief, 1.5 mL S. aureus suspension was centrifuged (CR21 Hitachi, Tokyo, Japan) at 12, 000 rpm for 1 min. The bacterial pellets were collected, then 600 µL Tris-EDTA (TE) buffer, 20 µL 100 mg/mL lysozyme (Invitrogen, CA, USA), 20 µL 10 mg/mL RNase (Invitrogen, CA, USA), were added and incubated at 37oC for 2.5 h, followed by an addition of 70 µL 10% SDS and 5 µL 20 mg/mL proteinase K (Sigma, New York, USA) at 37oC for 1 h. Subsequently, supernatant was extracted with phenol/chloroform/isoamyl alcohol (25: 24: 1) and centrifuged at 12, 000 rpm for 5 min. Finally, via isopropanol precipitation, washing with 70% ethanol, centrifugation and drying in sequence, the obtained DNA was diluted in 50 µL
PCR detecting mefA, msrA, erm, and 23S-rDNA genes
buffer. In addition, GTpureTM Kit (Gene Tech, Shanghai, China) was used to extract bacterial plasmids according to the product manual. Furthermore, a modified version of the PCR gene detection method described by Huang et al. (23) was performed. We used one pair of primers (synthesized by Sangon Biotech, Shanghai, China) for msrA, mefA, ermA, ermB, ermC, ermB promotor (ermB P), ermC promotor (ermC P), and 23 S-rDNA genes, respectively. The primer sequences were shown in Table 1. The 2×EasyTaq PCR Supermix systems (Takara, Dalian, China) were used for amplification of msrA, mefA, ermA, ermB, and ermC. The PCR reaction contained 2×Easy Taq PCR Supermix 10 µL, 25 pM forward primer 1 µL, 25 pM reverse primer 1 µL, DNA TermpLet 1 µL, and double distilled H2O 7 µL with 20 µL of the total volume. Different from the above reaction system, Fast Pfu enzyme (NEB, London, England) was applied for amplifying ermB P, ermC P and 23S-rDNA genes. The same reaction system was used for amplification of 23S-rDNA genes, whereas the following PCR system were used to amplify ermB P and ermC P genes: 5×PCR buffer 10 µL, 2.5 mM dNTPs 5 µL, 25 pM forward primer 1 µL, 25 pM reverse primer 1 µL, DNA Termplet 1 µL, 5 U/µL Fast Pfu polymerase 1 µL, ddH2O 31 µL, with 50 µL of total volume. The conditions of PCR reactions were listed in Table 2. All amplified PCR products were detected on 1% agarose gels electrophoresis and stained with ethidium bromide. PCR products were reclaimed and purified using Biospin GeL
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
172
Ding, Z.
Original Articles
Genes msrA mefA ermA ermB ermC 23S-rDNA ermB P ermC P
T( C) 94 94 94 94 94 94 94 94
o
Initial denaturation T(min) 5 5 5 5 5 2 2 2
Table 2: PCR programs for detecting relevant resistant genes. T( C) 94 94 94 94 94 94 94 94
o
Denaturation
T(sec) 45 45 45 45 45 15 15 15
T( C) 50 48 52 53 52 53 54 53
o
Annealing
T(sec) 50 40 50 50 50 15 15 15
T( C) 72 72 72 72 72 72 72 72
o
Extension
T(sec) 60 40 50 50 50 60 30 30
T( C) 72 72 72 72 72 72 72 72
o
Final elongation
T(min) 10 5 5 5 5 5 5 5
Cycles
30 30 30 30 30 30 30 30
Extraction Kit (Bioer, Hangzhou, China) according to the manufacture’s instruction.
strain, while the erythromycin-resistant strain ZJK-1 served as positive control strain.
Cloning ermB and ermC structural genes
For cloning the resistance determinants of S. aureus, PCR products were cloned into the pEASY-BLunt Vector (Takara, Dalian, China) (linking reaction composed of DNA 2.0 µL, pEASY-BLunt Vector 1.0 µL, mixed and incubated at 23oC for 15 min), and then transformed into the E. coli Transt-t1 strain (TianHe microorganism, Hangzhou, China) following standard protocols (24). The recombinant plasmid was identified with restriction enzyme BamH I and Sal I digestion (NEB, London, England) and 1% agarose gels electrophoresis. The obtained recombinant bacteria were cultured on agar plates containing 50 mg/ml erythromycin (Tianhe, Hangzhou, China), followed by determination of MIC changes. Transt-t1 strain was treated as the negative
Genes sequence analysis
Recombinant positive bacteria containing erythromycinresistant gene were stored in 40% glycerol, and sent to Shanghai Sunny Biological Co. Ltd, China for sequencing. The sequences were edited using SequencherTM (Gene Codes, Ann Arbor, MI) and aligned with other known sequences contained in the GenBank, and analyzed by BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) (25). RESULTS
MIC distribution and active efflux mechanism
The MIC distribution of erythromycin and the bacterial phenotype are presented in Table 3. Following the criterion
Figure 1. The results of D-Test of S. aureus. Clindamycin (Cli) and erythromycin (Ery) disks were placed onto the media from left to right in each plate. A: SH12 isolate was sensitive to both antibiotics; B: Z1 isolate displayed resistance to erythromycin and had a clindamycin zone ≥ 21mm (D+, iMLSB); C: SH4 isolate expressed resistance to both erythromycin and clindamycin (D-, cMLSB).
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
Methylase Genes-Mediated Erythromycin Resistance
173
Original Articles
ATCC21923 HLJ1
Isolates
K-B (mm) 26 7 6 -
Table 3: Erythromycin resistance, MICs of 26 strains isolated from bovine mastitis in China. MIC (μg/mL) 0.25 64 Phenotype S S Isolates SH-4 SH-5 K-B (mm) 7 7
MIC (μg/mL) 128 128
Phenotype R R
ATCC25923 L5-2
Z1
HS-2 Z3 Z4 AT
7
6 7 7 7
128
128 128 128 128
256
R
R R R R
R
R
SH-10 SH-14 HLJ23-1 HLJ4 HLJ3 SH-17
SH-8
SH-7
SH-6
6
7 7 6 6
7
128
128 128 128 128
256
R
R R R R S S
R
SH-3
SH-1
WH-1
HS-4
ZJK-1
7
7
7
6
6
128
128
256
128
256
R
R
R
R
R
SH-18
SH-12
SH-11
24
24
24
26
24
23
0.151
0.151
0.151
0.151
0.151
0.151
S
S
S
S
In K-B experiments, inhibitory diameter ≥ 23mm was determined as sensitivity (S), 14-23mm intermediate (I), ≤ 14mm resistance (R). In MIC analysis, < 0.5 µg/mL (S), 1-4 µg/mL (I), < 8 µg/mL (R).
(20), the reference strains (ATCC21923 and ATCC25923) tested in parallel with each batch of isolates, were within acceptable ranges on all occasions. There are no intermediate strains observed in susceptible experiments. Of the 26 isolates tested, only 6 (23.1%: HLJ23-1, HLJ4, HLJ3, SH-11, SH-12, and SH-18) strains were susceptible to the erythromycin. Twenty (76.9%) resistant isolates were identified by the antibiotic sensitivity test (K-B method). All the MICs of S. aureus strains resistant to erythromycin were also greater than 64 µg/mL. Among the 20 stains, 19 strains were highly resistant (MIC ranged from 128 to 256 µg/mL), and only 1 strain had an MIC of 64 µg/mL. Meanwhile, the 6 confirmed susceptible strains had the same MICs of 0.151 µg/ mL. Furthermore, in order to investigate whether these resistant strains were related to the active efflux mechanism, bacteria were cultured in special media with 20 µg/mL reserpine. The MICs of erythromycin-resistant strains cultured with reserpine showed no differences (P >0.05) compared to the MICs of those cultured without reserpine. The results indicated that there was no effect of the efflux inhibitor on the erythromycin resistance.
cin zone ≥ 21mm with a D-shaped (blunted zone near the erythromycin disk) zone were regarded as positive for inducible resistance (D+). Isolates resistant to erythromycin and clindamycin were considered negative for the D-test (D-) (26). In this study, 6 erythromycin-susceptible strains were also susceptible to clindamycin (Figure 1A), and two phenotypes of resistance to erythromycin and cyclines were
iMLSB and cMLSB resistance phenotypes
Isolates resistant to erythromycin and having a clindamy-
Figure 2. PCR detection of the relevant resistant genes of S. aureus isolated from bovine mastitis in China. From left to right in sequence: Marker (2000 Plus), HLJ1, L5-2, HS-2, Z1, Z3, Z4, AT, ZJK-1, HS4, WH-1, SH-1, SH-3, SH-4, SH-5, SH-6, SH-7, SH-8, SH-10, H-14, SH-17, HLJ23-1, HLJ4, HLJ3, SH-11, SH-12, SH-18 and negative control.
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
174
Ding, Z.
Original Articles
observed in S. aureus. Among the 20 erythromycin-resistant isolates, the tested 15 isolates (75%) were susceptible to clindamycin but resistant to erythromycin, which indicated they were detected as iMLSB phenotype (Figure 1B). Whereas, the other 5 isolates (25%), resistant to the both antibiotics, were considered negative for D-test and regarded as constitutive resistance phenotypes (Figure 1C). The percentages of iMLSB phenotype and cMLSB phenotype among the 26 isolates were 57.7% and 19.2%, respectively.
ermB and ermC genes associated with erythromycin resistance
The presence in all isolates of the msrA, mefA, ermA, ermB, ermC, ermB P, and ermC P genes responsible for erythromycin-resistance was confirmed by PCR analysis. Our analyses showed that no PCR products were amplified using msrA, mefA, and ermA primers for erythromycin-resistant detection. However, among the total tested isolates, 26 (ermB) and 22 (ermC) were amplified (Figure 2). The PCR detection of erythromycin-resistant genes showed that the size of amplified products detected by PCR was 738 bp (ermB) and 735 bp (ermC). The positive rates of ermB and ermC genes were (26/26) 100% and (22/26) 84.6%, respectively. The number of ermB and ermC genes coexisting in a bacterium was 22, which suggested the resistance may be related to the two genes. It was noteworthy that 6 (23.1%) of 26 ermB-carrying and 2 (9.1%) of 22 ermC-carrying S. aureus isolates were susceptible to erythromycin.
100% identity of ermB structural gene among HS-4, HLJ4, and transposon Tn551 (Genebank: Y13600), and the other 9 isolates had more than 99% similarity. Among the 9 isolates, homology comparison exhibited one mutation at position 27 (A→T) in the region of ermB P of SH-11 isolate, whereas the 100% identity among the other 8 isolates and the reference isolate may imply a relatively conserved status of the ermB P genes sequences. As for ermC, only one base mutation was detected in the -10 region of ermC P gene of ZJK-1 isolate. Identity of 100% in the promotor region and leader peptide region among the other isolates were determined, which demonstrated that base mutation mainly located in the structural gene sequence.
Slight mutation of erm structural gene is not responsible for methylase activity
If mutation causes a sequence alteration in a region of ermB and ermC genes or in their promotor regions, the secondary structure of methylase is also affected and may result in producing non-functional methylase or failure in its transcription and posttranscriptional modifications, which might cause susceptibility to erythromycin. In order to further investigate the reason that 6 ermB-carrying isolates (HLJ23-1, HLJ3, HLJ4, SH-11, SH-12 and SH-18) and 2 ermC-carrying isolates (HLJ23-1 and HLJ4) susceptible to erythromycin, ermB, ermC and their promotor genes were sequenced and their mutation analyses performed. Five erythromycinresistant isolates carrying erm genes (ZJK-1, HS-4, WH-1, SH-5 and SH-8) served as reference strains. The results of the sequence comparison are represented in Table 4. We found a
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
Mutation of ermB, ermC mainly occurred in structural genes
Because the above mutation analysis indicated that a much lower base mutation occurred in the promotor region, we speculated that mutations may exist in structural genes which would be responsible for methylase activity. Accordingly, ermB and ermC genes were cloned into pMD18-T vector and transformed into erythromycin-susceptible bacterium (Transt-t1). MICs of transformed bacteria were determined. Compared with negative strains (Transt-t1), bacteria transformed with resistant genes displayed stronger resistant characteristics, and their MICs significantly increased to 200 µg/ mL, which was interpreted that a mutation of ermB and ermC genes in the structural region did not result in inactivation of methylase.
Alteration of 23S-rRNA may lead to erythromycin susceptibility
It have been reported that the induced appearance of erythromycin resistance in S. aureus is accompanied by methylation of the 23S-rRNA (27). However, the mutation that has been reported to affect the ribosomal structure and function has been those in which a ribosomal protein was altered. The phenotypes of these mutations have shown antibiotic resistance (28). The sequences of 23S-rRNA genes among the 6 ermB-carrying isolates were analyzed and the results are listed in Table 5. Homogeneity assay using DNAstar software package (Version 7.1) indicated the 99.9% homology compared to the Newman strain 23S-rRNA (Genebank: AP009351). Each isolate at least contained one base mutation. Both mutations of SH-11 and SH-12 were located at
Methylase Genes-Mediated Erythromycin Resistance
175
Original Articles
Genes ermB
ermC
Isolates HLJ23-1 HLJ3 HLJ4 SH-11 SH-12 SH-18 HLJ23-1 HLJ4
Promotor
Leader sequence 115 (A→G), 251 (A→G)
Table 4: Base changes of ermB and ermC genes.
Structural gene 495 (C→T), 497 (T→C), 572 (A→G) 333 (A→G), 822 (A→G)
27 (A→T)
251 (A→G) 251 (A→G)
662 (T→C) 435 (A→G), 497 (T→C), 572 (A→G), 871 (C→G), 913 (G→A) 495 (C→T), 497 (T→C), 572 (A→G), 871 (C→G), 913 (G→A) 485 (T→G), 643 (A→G) 398 (T→G), 781 (A→G)
of the MICs of the resistant strain were ≥ 128 µg/mL. The resistance rate (76.9%) was obviously higher than the results obtained from other HLJ3 countries (30-33), but much lower HLJ4 than the rate of 93.1% reported by SH-11 989 (A→G) Wang et al. (8). This high prevalence SH-12 989 (A→G) of erythromycin-resistant isolates 716 (C deletion), 775 (A→G), 1192 (A→G), 1227 (T→C), 1917(A→G), 2480 (A→T) SH-18 may be related to high prevalence of bovine mastitis in China (2), which portends the further complication in the position 989 (A→G) of the 23S-rRNA genes. A base dethe treatment of S. aureus-induced bovine mastitis. letion occurred in SH-18 (716C) and HLJ23-1 (C2746). We One significant contribution to intrinsic antibiotic resishave observed that the mutation frequency of A→G were tance is provided by a number of broadly-specific multi-drug efflux systems which can play an important role in export of significantly higher than other base mutations. More imantibiotics (34). It is well known that reserpine is a useful portantly, a mutation at position 2057 (AG) of 23S-rRNA in efflux pump inhibitor to combat antibiotic-resistant microHLJ3 isolate implied that the alteration of 23S-rRNA genes organisms (21). We investigated whether this resistance was may affect the methylation site. caused by the active efflux mechanism in the reserpine-resistant bacteria. The results indicated no effects of efflux inhibiDISCUSSION tor on the erythromycin resistance, which implied that the S. aureus is one of the important pathogens causing bovine active efflux mechanism in these resistant bacteria were inmastitis. It has become a great matter of concern because activated, or even did not exist in the resistant bacteria at all. more than half of the bacteria possess antibiotic resistance In addition, we also distinguished susceptibility patterns of S. (5, 29). Erythromycin has been approved for the treatment aureus between phenotypes for further testing. Constitutive of Staphylococcal mastitis in veterinary practice in China resistance demonstrates resistance to all of the MLSB groups, for more than half a century. Nevertheless, in the last two but inducible resistance is present with an inducing agent, decades, erythromycin-resistant S. aureus isolates have besuch as erythromycin. Susceptibility testing of these isolates come an increasingly recognized problem in many parts of using adjacent erythromycin and clindamycin antibiotic discs China (8). Investigating the spread of erythromycin-resistant demonstrated the classical D-zone to be indicative of a posigenes in S. aureus is important for controlling its disseminative D-test in all cases (9). Previous studies have shown a tion in bovine mastitis. In our study, 20 of 26 S. aureus isovariable incidence of inducible resistance among the tested Staphylococcal populations (4). In our D-test, 15 (D+, 75%) lates displayed significant erythromycin resistance, and 95%
Isolates HLJ23-1 Base change location 558 (A→G), 1090 (A→G), 1243 (G→A), 1550 (G→A), 1750 (T→C) 1848 (A→G), 2312 (C→T), 2360 (A→G), 2396 (A→G), 2746 (C deletion) 182 (C→A), 1019 (A→G), 1896 (T→G), 2057 (A→G), 2569(A→G) 44 (A→G), 2746 (G→A)
Table 5: Base changes of 23S-rDNA gene.
176
Ding, Z.
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
Original Articles
and 5 (D-, 25%) isolates exhibited iMLSB and cMLSB phenotypes among the 20 resistant isolates, respectively. Rich et al. (35) reported 71.8% incidence of iMLSB in 285 strains from a variety of clinical infectious between January 2003 and December 2004 in UK. At the same time, the rate of our iMLSB phenotype was much higher than that (52.8%) of Inner Mongolia isolates found by Wang et al. (8), which were suggested that there might exist a potential risk of the failure of erythromycin and clindamycin therapy for treating S. aureus-induced bovine clinical mastitis. Two phenotypes are related with resistant genes such as erm, msr, and mef (23). Hence, the need for the rapid and reliable identification of these genes and the investigation of the relationship with susceptible patterns has become more important (17). We detected mefA, msrA, and main erm genes using PCR with primers specific for the genes responsible for erythromycin resistance. It was found that neither mefA and msrA was detected among the resistant isolates, which further supported the evidence that efflux mechanism does not exist in the resistant isolates. To our knowledge, there have been no previous studies for the detection of ermA in S. aureus veterinary clinical isolates in China. In our results, no PCR products of erythromycin-resistant gene ermA was observed. However, the ermA was detected in all erythromycinresistant MRSA (meticillin-resistant S. aureus) isolates from human clinical hospitals (17). This finding was also shown by Sekiguchi et al. (36) who reported that ermA is predominantly found in S. aureus isolates. The discrepancy between our findings and previous studies need to be further investigated. On the other hand the incidence of resistance genes, ermB genes were determined in 100% (26/26) of examined isolates and in 100% (20/20) of resistant isolates. The other resistant gene, ermC gene, was detected in 84.6% (22/26) of tested isolates and in 100% (20/20) of resistant isolates. Both genes were detected together in 22 of the resistant isolates (84.6%). In conformity to these results, the ermB gene was encountered more frequently among 26 isolates and the two genes exhibited same incidence in the resistant isolates. Wang et al. (8) found that the ermB gene was found mainly in cML isolates (87.5%), while the ermC gene was more common in isolates with iML phenotype (100%). Ardic et al. (29) reported that the detection rates of ermC genes were 64.3% in 56 methicillin-resistant Staphylococcal isoIsrael Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
lates. These findings were similar to our findings, except for the determination of the ermC gene. To date, there has been no previous report on the susceptible isolates containing resistant genes. Interestingly, in present study 6 erythromycin-susceptible isolates (HLJ23-1, HLJ4, HLJ3, SH-11, SH-12, and SH-18, MICs ≤ 0.151µg/ mL) were presented in ermB-carrying isolates, and 2 susceptible isolates (HLJ23-1 and HLJ4) were detected in both ermB- and ermC-carrying isolates. Sequence analysis detected only one mutation at position 27 (A→T) in the region of ermB promotor of SH-11 isolate, whereas two mutations occurred at position 115 (A→G) and 215 (A→G) in the region of leader peptide of HLJ23-1 isolate, which demonstrated that much lower base mutations occurred in the non-structural region. In order to investigate whether the mutation in structural gene of erm plays a crucial role in erythromycin susceptibility, erm genes were cloned into erythromycin-susceptible Transt-t1 bacterium. MICs of transformed bacteria significantly increased to 200 µg/mL, which proved that transformed bacteria had acquired stronger resistant characteristics. This evidence proved that slight mutations of ermB and ermC genes in the structural region did not affect the activity of methylase. On the basis of the above findings, we proposed that the mutation of 23S-rRNA may play a significant role in erythromycin susceptibility. A majority change of (G) mainly occurred in 23S-rRNA sequence, in accordance with the mutation of the resistant gene. Each isolate at least contained one base change. The methylation site occurred at position 2058 of 23S-rRNA (15). The conformational changes which occured in the P site of ribosome protein prevented macrolide binding (9). However, the detected mutation at position 2057 (AG) of 23S-rRNA in HLJ3 isolate which is near the position 2058 may influence methylation of P site and result in the rebinding of erythromycin. Similarly, Douthwaite (37) reported that three base substitutions at position 2032 of 23S-rRNA produce an erythromycin-hypersensitive phenotype. From this, we presumed that susceptible isolates were possibly engendered by the alteration of 23S-rRNA structure leading to the inability of the methylation, which could not prevent the rebinding of erythromycin. The evidence sufficiently illustrated that ribosome methylases encoded by ermB and ermC genes played a vital role in the resistance of S. aureus from bovine mastitis in China. In conclusion, our results demonstrated a high proportion of inducible erythromycin-resistant S. aureus from cliniMethylase Genes-Mediated Erythromycin Resistance
177
Original Articles
cal bovine mastitis in China. Erythromycin resistance was caused mainly by methylation of 23S-rRNA encoding by ermB and ermC genes. In this study we initially found that the mutation of 23S-rRNA gave rise to many erythromycin-susceptible isolates by possibly disturbing the site of the methylation, allowing erythromycin to bind to the ribosome. The exact mutation site and its mechanism need to be further investigated.
Conflict of interest statement
All authors declare that they do not have any financial or personal relationships with other people or organizations that could inappropriately influence (bias) their work.
This study was supported by National Natural Science Foundation of China (NSFC, Grant No. 31072120). We are sincerely grateful to Hongqiong Zhao (Xinjiang Agricultural University & Obihiro University of Agriculture and Veterinary Medicine) for reviewing the manuscript. ACKNOWLED GEMENTS
1. Hu, S. H., Fang, W. H., Lu, H. R., Jiang, C. S., Zhu, P. M., Ye, J. N., Ye, D. S., and Yan, H. T.: Effect of teat dipping and dry cow therapy on mastitis in a commercial dairy herd in China. Prev. Vet. Med. 10: 91-96, 1990. 2. Wang, S. C., Wu, C. M., Xia, S. C., Qi, Y. H., Xia, L. N., and Shen, J. Z.: Distribution of superantigenic toxin genes in Staphylococcus aureus isolates from milk samples of bovine subclinical mastitis cases in two major diary production regions of China. Vet. Microbiol. 137: 276-281, 2009. 3. Hu, C. M., Gong, R., Guo, A. Z., and Chen, H. C.: Protective effect of ligand-binding domain of fibronectin-binding protein on mastitis induced by Staphylococcus aureus in mice. Vaccine. 28: 4038-4044, 2010. 4. Botrel, M. A., Haenni, M., Morignat, E., Sulpice, P., Madec, J. Y., and Calavas, D.: Distribution and antimicrobial resistance of clinical and subclinical mastitis pathogens in dairy cows in Rhône-Alpes, France. Foodborne. Pathog. Dis. 7: 479-487, 2010. 5. Ardic, N., Ozyurt, M., Sareyyupoglu, B., and Haznedaroglu, T.: Investigation of erythromycin and tetracycline resistance genes in methicillin-resistant Staphylococci. Int. J. Antimicrob. Agents 26: 213-218, 2005. 6. Fthenakis, G. G.: Susceptibility to antibiotics of Staphylococcal isolates from cases of ovine or bovine mastitis in Greece. Small. Rumin. Res. 28: 9-13, 1998. 7. Dingwell, R. T., Leslie, K. E., Duffield, T. F., Schukken, Y. H., DesCoteaux, L., Keefe, G. P., Kelton, D. F., Lissemore, K. D., Shewfelt, W., Dick, P., and Bagg, R.: Efficacy of intramammary tilmicosin and risk factors for cure of Staphylococcus aureus infection in the dry period. J. Dairy. Sci. 86: 159-168, 2003.
REFERENCES
8. Wang, Y., Wu, C. M., Lu, L. M., Ren, G. W. N., Cao, X. Y., and Shen, J. Z.: Macrolide-lincosamide-resistant phenotypes and genotypes of Staphylococcus aureus isolated from bovine clinical mastitis. Vet. Microbiol. 130: 118-125, 2008. 9. Leclercq, R.: Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 34: 482-492, 2002. 10. Ross, J. I., Eady, E. A., Cove, J. H., Cunliffe, W. J., Baumberg, S., and Wootton, J. C.: Inducible erythromycin resistance in Staphylococci is encoded by a member of the ATP-binding transport super-gene family. Microbiology. 4: 1207-1214, 1990. 11. Roberts, M. C.: Distribution of macrolide, lincosamide, streptogramin, ketolide and oxazolidinone (MLSKO) resistance genes in Gram-negative bacteria. Curr. Drug. Targets. Infect. Disord. 4: 207-215, 2004. 12. Roberts, M. C., Sutcliffe, J., Courvalin, P., Jensen, L. B., Rood, J., and Seppala, H.: Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents. Chemother. 43: 2823-2830, 1999. 13. Peche’re, J. C.: Macrolide resistance mechanisms in Gram-positive cocci. Int. J. Antimicrobial. Agents. 18: 25-28, 2001. 14. Schmitt-Van de Leemput, E., and Zadoks, R. N.: Genotypic and phenotypic detection of macrolide and lincosamide resistance in Streptococcus uberis. J. Dairy. Sci. 90: 5089-5096, 2007. 15. Lai, C. J., and Weisblum, B.: Altered methylation of ribosomal RNA in an erythromycin-resistant strain of Staphylococcus aureus. PNAS. 68: 856-860, 1971. 16. Wang, B., Liu, M. C., Wu, C. M., Song, L. H., and Shen, J. Z.: Antimicrobial susceptibility of Staphylococcus aureus isolated from Bovine mastitis in Hohehot. Chin J. Vet. Med. 43: 30-32, 2007. 17. Sabet, N. S., Subramaniam, G., Navaratnam, P., and Sekaran, S. D.: Detection of mecA and ermA genes and simultaneous identification of Staphylococcus aureus using triplex real-time PCR from Malaysian S. aureus strain collections. Int. J. Antimicrobial. Agents. 29: 582-585, 2007. 18. Martineau, F., Picard, F. J., Roy, P. H., Ouellette, M., and Bergeron, M. G.: Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. J. Clin. Microbiol. 36: 618-623, 1998. 19. CLSI. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Informational supplement (M31-S1). CLSI, Wayne, PA, 2004. 20. CLSI. Performance standards for antimicrobial susceptibility testing. 15th Informational Supplement (M100-S15). CLSI, Wayne, PA., 2005. 21. Garvey, M. I., and Piddock, L. J. V.: The efflux pump inhibitor reserpine selects multidrug-resistant Streptococcus pneumoniae strains that overexpress the ABC transporters PatA and PatB. Antimicrob. Agents. Chemother. 52: 1677-1685, 2008. 22. Gherardi, G., De Florio, L., Lorino, G., Fico, L., and Dicuonzo, G.: Macrolide resistance genotypes and phenotypes among erythromycin-resistant clinical isolates of Staphylococcus aureus and coagulase-negative Staphylococci, Italy. FEMS. Immuno. Medi. Microbiol. 55: 62-67, 2009. 23. Hung, S. W., Wang, S. L., Tu, C. Y., Tsai, Y. C., Chuang, S. T., Shieh, M. T., Liu, P. C., and Wang, W. S.: Antibiotic susceptiIsrael Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
178
Ding, Z.
Original Articles
24. 25.
26.
27.
28. 29.
30.
bility and prevalence of erythromycin ribosomal methylase gene, erm(B) in Streptococcus spp. Vet. J. 176: 197-204, 2008. Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular cloning: a laboratory manual, 2nd edition. Cold spring harbor laboratory press, Cold spring harbor, NY., 2001. Altschul, S. F., Madden, T. L., SchaÈffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J.: Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic. Acids. Res. 25: 3389-3402, 1997. Manju, Y. K., Elizabeth, J. B. M., and Michael, T. C.: Constitutive and inducible clindamycin resistance in Staphylococcus aureus and their association with meticillin-resistant S. aureus (MRSA): experience from a tertiary care hospital in Nepal. Int. J. Antimicrobial. Agents. 33: 187-189, 2009. Helser, T. L., Davies, J. E., and Dahlberg, J. E.: Change in methylation of 16S ribosomal RNA associated with mutation to kasugamycin resistance in Escherichia coli. Nat. New. Biol. 233: 1214, 1971. Ettayebi, M., Prasad, S. M., and Morgan, E. A.: Chloramphenicol-erythromycin resistance mutations in a 23S rRNA gene of Escherichia coli. J. Bacteriol. 162: 551-557, 1985. Ardic, N., Ozyurt, M., Sareyyupoglu, B., and Haznedaroglu, T.: Investigation of erythromycin and tetracycline resistance genes in methicillin-resistant staphylococci. International Journal of Antimicrobial Agents. 26: 213-218, 2005. Bonnier, M., Dore´, C., Ame´de´o, J., and Gue´rin-fauble´e, V.: In
31.
32.
33. 34. 35. 36.
37.
vitro activity of tylosin and tilmicosin against cocci isolated form bovine mastitis. Revue de Med. Vet. 157: 486-489, 2006. Gentilini, E., Denamiel, G., Llorente, P., Godaly, S., Rebuelto, M., and DeGregorio, O.: Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine mastitis in Argentina. J. Dairy. Sci. 83: 1224-1227, 2000. Vintov, J., Aarestrup, F. M., Zinn, C. E., and Olsen, J. E.: Association between phage types and antimicrobial resistance among bovine Staphylococcus aureus from 10 countries. Vet. Microbiol. 95: 133-147, 2003. Shitandi, A., and Sternesjö, Å.: Prevalence of multidrug resistant Staphylococcus aureus in milk from large- and small-scale producers in Kenya. J. Dairy. Sci. 87: 4145–4149, 2004. Poole, K.: Multidrug efflux pumps and antimicrobial resistance in Pseudomonas aeruginosa and related organisms. J. Mol. Microbiol. Biotechnol. 3: 255-264, 2001. Rich, M., Deighton, L., and Roberts, L.: Clindamycin-resistance in methicillin-resistant Staphylococcus aureus isolated from animals. Vet. Microbiol. 111: 237-240, 2005. Sekiguchi, J., Fujino, T., Saruta, K., Kawano, F., Takami, J., Miyazaki, H., Kuratsuji, T., Yoshikura, H., and Kirikae, T.: Spread of erythromycin-, tetracycline-, and aminoglycoside-resistant genes in methicillin-resistant Staphylococcus aureus clinical isolates in a Kumamoto Hospital. Jpn. J. Infect. Dis. 56: 133-137, 2003. Douthwaite, S.: Functional interactions within 23S rRNA involving the peptidyltransferase center. J. Bacteriol. 174: 13331338, 1992.
Israel Journal of Veterinary Medicine  Vol. 67 (3)  September 2012
Methylase Genes-Mediated Erythromycin Resistance
179