Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 221 CSFV Changes Interleukin Expression
INTRODUCTION
Classical Swine Fever Virus (CSFV), the highly contagious
agent of CSF, is a positive-sense single-stranded RNA virus.
Te infection causes severe economic losses in the pig indus-
try especially in developing countries (1). Te virus has a high
afnity for the cells of the immune system such as myeloid
cells including macrophages and dendritic cells (DCs), and
interferes with cellular antiviral defenses (2). Furthermore,
CSFV can efciently evade and compromise the host im-
mune system, causing a severe disease of pigs characterized
by fever, hemorrhage, thrombocytopenia and lymphoid organ
atrophy severe lymphopenia, particularly in B cells, due to
the apoptosis of uninfected lymphocytes (3,4). Te invasion
of CSFV to the host immune system can cause severe lym-
phopenia which is the hallmark of CSFV infection, resulting
in immunosuppression. At present, many countries including
the European Union (EU) member states have used difer-
ent strategies for the eradication of CSF in wild boar and in
domestic pigs (5). However, some developing countries such
as China, India and Africa have pointed out difcult methods
to eradicate this complex disease, even though vaccination
against CSFV has been applied. In addition, CSF epidemics
appeared in these countries with no typical clinical symptoms,
leading to the difculties in accurate diagnosis, monitoring
and prevention of this disease (6). Recently, atypical CSF has
been found in many areas of China. It suggests that atypi-
cal CSF is also caused by CSFV, but compared to CSF, its
epidemiology, clinical symptoms, pathological changes are
not classical. Furthermore, atypical CSF often occurs in the
pigs inoculated with vaccines and its latent period is very
long. Te previous fndings demonstrated that sows in dif-
ferent stages of pregnancy inoculated with a low-virulence
Atypical Classical Swine Fever Infection Changes Interleukin
Gene Expression in Pigs
Sun, Y.K.,
1,2
Zhang, X.M.,
2
Du, M.,
2
Li, Y.X.,
2
Pan, H.B.,
2
Yan, Y.L.,
2
and Yang, Y.A.
2
*
1
State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural
Sciences, Haerbin, 150001, China.
2
College of Animal Science and Technology, Yunnan Agricultural University, Kunming, 650201, China.
*
Corresponding Author: DR. Y.A. Yang, College of Animal Science and Technology, Yunnan Agricultural University, 427 Jinhei road, Kunming, 650201,
China. Tel and Fax: 86-871-65220061, Email: yangyuai2013@163.com
ABSTRACT
Several studies have highlighted the important role of cytokines in disease development of classical swine
fever virus (CSFV) infection. In the present study, we examined the changes of body temperature, viral
replication and leukocytes, and the kinetics of four porcine interleukins (ILs) in serum from pigs infected
with CSFV strains which lead to the atypical CSF during 45 days post infection (dpi). Te results showed
that compared to those uninfected pigs with CSFV, CSFV-infected pigs had higher temperature and
viral replication while showing less leukocytes. Furthermore, using reverse transcription polymerase chain
reaction (RT-PCR), the cytokines IL-1, IL-2 and IL-4 in white blood cells of pigs were measured showing
increased levels after CSFV infection. However, the cytokine IL-8 level of the CSFV-infected pigs was
downregulated before 10 dpi and peaked at 25 dpi. Tese fndings may indicate that IL-1, IL-2, IL-4 and
IL-8 are involved in the immune response during CSFV infection.
Keywords: CSFV; RT-PCR; Interleukin; Viral Replication; Temperature; Leukocyte.
DECEMBER Book.indb 221 04/12/2014 10:57:14
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 Sun, Y.K. 222
CSFV strain showed no clinical signs of disease, but most of
their pigs showed splay-leg with nervous disorders and died.
Te pigs which survived were immunotolerant but remained
unapparent carriers of virus. Virus was transmitted from im-
munotolerant pigs to susceptible pigs by contact 5 weeks but
not 3 months after farrowing (7).
In the present study, during diferent periods of CSFV
infection, the clinical symptoms and the changes of cytokines
IL-1, IL-2, IL-4 and IL-8 were investigated, providing the
evidence that the observed gene expression profle of these
cytokines might explain immunological and pathological
changes associated with atypical CSFV infections.
MATERIALS AND METHODS
Virus
Te wild-type CSFV strain named CSFV-YN-2009 was
originally isolated from lymphoid tissue of a pig with
naturally occurring atypical CSF. Virus titres were deter-
mined and calculated as described previously (8). Te virus
(1.0×10
5.2
TCID
50
/ml) were preserved and stored at -80°C
in Laboratory of Viruses, College of Animal Science, Yunnan
Agricultural University.
Animal and treatment
Pigs negative by RT-PCR and seronegative of CSFV, bovine
viral diarrhea viruses (BVDV), porcine respiratory and repro-
ductive syndrome virus (PRRSV), porcine circovirus type 2
(PCV2), porcine pseudorabies virus (PRV), porcine parvovi-
rus (PPV) and foot-and-mouth disease virus (FMDV) were
selected among 25-day-old Yorkshire pigs. Eight negative
pigs were intramuscularly injected with l ml atypical CSFV
strain (1.0×10
3
TCID
50
/ml), and 8 negative pigs served as
controls were imjected intramuscularly with l ml physiologi-
cal saline. Body temperature and clinical symptoms were re-
corded daily post-infection.
PBMC isolation
At -1, 0, 1, 2, 4, 7, 10, 13, 17, 21, 25, 30, 35, 40 and 45 dpi,
10 ml blood was collected from the anterior vena cava of the
pigs and placed into sodium heparin-CPT tubes and EDTA.
Following collection, blood sample with EDTA anticoagu-
lant was mixed with 5 ml hydroxypropylmethyl cellulose, and
washed three times with phosphate bufered saline (PBS) at
4°C, and centrifuged at 1500 rmp/min for 10 minutes.
After centrifugation, further investigations were carried
out in two ways: (1) 0.1mol/l hydrochloric acid was added
to dilute the leukocyte preparation (1:20), and mononuclear
leukocytes were counted using light microscopy (Olympus,
Japan); (2) the bufy coat layer was transferred to a 15 ml
RNase free tube, diluted with an equal volume of PBS, and
centrifuged at 1500 rpm/min for 20 min at room tempera-
ture. Te supernatant was discarded and peripheral blood
mononuclear cells (PBMCs) were diluted with 9 ml red cell
lysate, and centrifuged at 1000 rpm/min for 10 min at room
temperature after placement in an ice bath for 2-3 min. Te
supernatants were discarded and PBMCs were diluted with
PBS three times. PBMCs were retained and used to for the
detection of IL-1, IL-2, IL-4 and IL-8 expression.
Te in vivo experiment in this study was carried out ac-
cording to the recommendations in the Guide for the Care
and Use of Laboratory Animals of the National Institutes of
Health. Te protocol was approved by Experimental Animal
Center of Yunnan Province (Permit Number: 13-268). All
surgery was performed under sodium pentobarbital anesthe-
sia, and all eforts were made to minimize sufering.
RT-PCR
Expression of IL-1, IL-2, IL-4 and IL-8 in PBMCs was
determined by RNA preparation and reverse transcription
polymerase chain reaction (RT-PCR) using SYBR Premix
Ex Taq
TM
kit (TaKaRa, Osaka, Japan). Briefy, total cel-
lular RNA was isolated from PBMCs by the guanidine
thiocyanate/phenol-chloroform extraction method using
TRIZOL reagent following the manufacturer’s instructions
(Invitrogen, Carlsbad, CA, USA). RNA quality was assessed
by agarose gel electophoresis and complementary DNA
(cDNA) was synthesized with random hexamer (TaKaRa,
Osaka, Japan). RT-PCR was performed using the ABI
Prism 7500 Sequence Detector (Applied Biosystems, Foster
City, CA, USA) according to the manufacturer’s protocol.
Te PCR reaction was carried out at 1 cycle of 50°C for 3
min and 95°C for 10 min, followed by 40 cycles of 95°C
for 30 s, 55°C for 45 s and 72°C for 30 s. We used β-actin
expression as an internal control. Quantifcation of gene
expression was performed by the 2-
∆∆Ct
method. Specifc
primer sequences were designed using Oligo 6.0 software
and synthesized in BIOSUNE Biological Technology Corp
(Shanghai, China), and the sequences of the primers were
shown in Table 1.
Research Articles
DECEMBER Book.indb 222 04/12/2014 10:57:14
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 223 CSFV Changes Interleukin Expression
Quantifcation of viral replication
Viral RNA was extracted using the MiniBEST Viral
RNA/DNA Extraction Kit Ver. 4.0 (TaKaRa, Osaka,
Japan), and the synthesis of cDNA was performed us-
ing the PrimeScript®RT reagent Kit (TaKaRa, Osaka,
Japan) according to the manufacturer’s protocol. Real-
time quantitative reverse transcriptase polymerase chain
reaction (qRT-PCR) was used to detect virus copies as
described in previous study (9).
Statistical analysis
Te data were analyzed by one-way analysis of variance
and by Student’s t-test with Bonferroni correction using
SPSS15.0 software. All numerical data were collected from
at least three separate experiments. Te results were expressed
as means ± standard deviation of the means. Te diferences
were considered signifcant at a level of P<0.05.
RESULTS
Clinical symptoms after CSFV infection
At 1-5 dpi, the appetite and the mental state of pigs were
normal. After 5 dpi, the body temperature began to increase
accompanied by mild mental depression, slight conjuncti-
val fushing and food-consumption reduction. By 9 dpi of
atypical CSFV, body temperature was elevated to 41.3°C,
and decreased signifcantly in the following days. By 45 dpi,
body temperature of pigs was decreased to 39.8°C, which
was still higher than that of uninfected pigs. As a control, the
uninfected pigs did not show the clinical symptoms, and body
temperature remained at 39.2-39.4°C (Fig.1).
Changes of leukocytes and viral replication
As shown in Fig.2A, the average total number of leukocytes
in CSFV infected pigs declined from 2.08×10
7
cells/ml to
1.94×10
7
cells/ml at 2 dpi, and to 1.39×10
7
cells/ml at 4 dpi
(P<0.05). A rapid onset of mononuclear lymphocytopenia
Figure 1: Changes of the rectal temperature of the infected pigs. Following infection with CSFV isolate, clinical signs and body temperature
were recorded. Results are expressed as the mean data for each group of pigs and error bars represent standard deviation.
Table 1: Nucleotide sequences of primers for real-time PCR
Gene Sequence of primers 5’-3’
Size
(bp)
GenBank
Number
β-actin
F: CCTGACCCTCAAGTACCCCA
R: GCTCGTTGTAGAAGGTGTGGTG
89 U16368.1
IL-1β
F: ACCAGGGTTACTGACTATGGC
R: GTTGAGGCAGGAAGGAGAT
337 NM_214029.1
IL-2
F: GCACTCATGGCAAACGGTGCA
R: GTTACTGTCTCATCATCATATT
362 FJ543109.1
IL-4
F: AACCCTGGTCTGCTTACTG
R: CATAATCGTCTTTAGCCTTTC
352 NM_214123.1
IL-8
F: AGCCCGTGTCAACATGACTTCC
R: GAAGTTGTGTTGGCATCTTTA
394 NM_213867.1
Research Articles
DECEMBER Book.indb 223 04/12/2014 10:57:14
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 Sun, Y.K. 224
was also detected at 7 dpi in in-
fected pigs, the number of leuko-
cytes declined to 1.15×10
7
cells/
ml (P<0.05). Tere was a slight
increase in the number of leuko-
cytes at 10 dpi which stabilized at
21 dpi. Te number of leukocytes
of pigs in the control group was
maintained at 1.85-2.18×10
7
cells/
ml. Tis result confrmed the de-
pletion of mononuclear leukocytes
in atypical CSFV infected pigs.
Te fndings of CSFV replication
detected by qRT-PCR indicated
that viral replication increased
rapidly after challenge of CSFV
in pigs and reached the highest
peak at 10 dpi, and deceased in the following days (Fig.2B).
Changes of interleukin expression in PBMC
Te PBMC cytokine secretion in response to CSFV stimula-
tion was measured by RT-PCR, and the results are shown in
Figures 3-6. Results in Figure 3 showed that, compared to
the control (virus uninfected pigs), IL-1β mRNA transcrip-
tion level began to increase at 1 dpi. It peaked at 17 dpi,
which was 259 times as many as that of the control. Ten it
slightly decreased, but still remained 100 times higher than
that of the control (Figure 3) indicating that CSFV infection
induced IL-1β mRNA expression signifcantly (P<0.05).
Compared to the controls after CSFV infection the
mRNA transcript level of IL-2 was increased sharply start-
ing from 1 dpi, and followed by a slight decrease. However,
at 10 dpi, IL-2 expression increased again and reached a peak
of 230 times greater than the control and continued to stay at
high levels. After 35 dpi, IL-2 levels were still 100 times as
higher than the controls, indicating that CSFV upregulated
IL-2 mRNA transcription level signifcantly in the early
stages of virus infection (Figure 4).
As illustrated in Figure 5, compared with the control,
IL-4 mRNA expression was induced in the early stages of
CSFV infection. It started to increase rapidly by 5-7 times
from 1 dpi, and was slightly downregulated at 7 dpi. At the
beginning of 9 dpi, a sharp increase was observed, and a
peak (increased by 231 times) was found at 25 dpi. In the
following days, IL-4 levels were decreased but still kept at
high levels (P<0.05).
In addition, IL-8 mRNA expression was changed after
infection of CSFV. It demonstrated that IL-8 level was de-
creased by 2.89 times and 9.29 times, respectively at 4 dpi and
7 dpi. At 10 dpi, IL-8 mRNA expression began to increase and
reached their peak at 25 dpi (about 41 times), and continued to
stay at high expression levels in the following days (Figure 6).
DISCUSSION
Classical swine fever (CSF), a highly contagious hemor-
rhagic viral disease of pigs, not only runs an acute, sub-acute,
chronic or late onset course, but also may be subclinical (10).
CSF outbreaks often lead to extensive epidemics in areas
with a high density of pigs (11). In this study, we investigated
the changes of body temperature, lymphocyte counts, and the
kinetics of porcine IL-1, IL-2, IL-4 and IL-8 in PBMCs
isolated from pigs infected with CSFV strain which lead to
the atypical CSF during 45 dpi.
In our study, we demonstrated that body temperature of
CSFV infected pigs was only 39.4°C at 3 dpi and reached the
highest 41.3°C at 10dpi, then decreased gradually. At 15 dpi,
the temperature showed a stable trend, and was 0.5-0.7°C
higher than that of the control group. As reported by Li et
al. (2006), treatment with the same dose of virulent Shimen
strain virus the body temperature of pigs reached 41.4°C at
3 dpi, and the highest temperature was 42.5°C (12). Tis
discrepancy probably was due to the virulence of CSFV.
Figure 2: Leukocyte counts and viral replication in peripheral blood of pigs in infection and control
groups. (A) After infection with CSFV isolate, leukocyte numbers in peripheral blood of pigs were
measured. (B) Viral replication in blood was determined by qRT-PCR. Results are expressed as the
mean data for each group of pigs and error bars represent standard deviation.
Research Articles
DECEMBER Book.indb 224 04/12/2014 10:57:15
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 225 CSFV Changes Interleukin Expression
Figure 3: Te concentrations of IL-1β in PBMCs of inoculated pigs (n=8) and pigs inoculated with CSF virus (n=8 pigs).
Analyses of peripheral blood cell cytokine responses by stimulation of CSFV isolate. PBMC were isolated and cytokine IL-1β
expression was analyzed using RT-PCR. Results are expressed as the mean data for each group of pigs and error bars represent
standard deviation.
Figure 4: Te kinetics of IL-2 mRNA in PBMCs of pigs. Analyses of peripheral blood cell cytokine responses by stimulation
of CSFV isolate. PBMC were isolated and cytokine IL-2 expression was analyzed using RT-PCR. Results are expressed as
the mean data for each group of pigs and error bars represent standard deviation.
Figure 5: Te kinetics of IL-4 mRNA in PBMCs of pigs. Analyses of peripheral blood cell cytokine responses by stimulation
of CSFV isolate. PBMC were isolated and cytokine IL-4 expression was analyzed using RT-PCR. Results are expressed as
the mean data for each group of pigs and error bars represent standard deviation.
Research Articles
DECEMBER Book.indb 225 04/12/2014 10:57:15
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 Sun, Y.K. 226
CSFV infection caused severe leukopenia, particularly
afecting the lymphocytes. Te target cells for CSFV in the
peripheral blood appeared to be mainly monocytes, lympho-
cytes and granulocytic cells, but all leukocyte populations may
be depleted during CSFV infection (13). Our study also sug-
gested that the number of leukocytes in CSFV infected pigs
was reduced, which might predispose the pigs to secondary
diseases. Peripheral blood mononuclear cells are a heterog-
enous population of blood cells that include monocyte and
lymphocytic immune cells consisting of T-cells, B-cells and
natural killer (NK) cells. Tese blood cells represent a critical
component in the immune system for fghting infection and
adapting to intruders. So, PBMCs have emerged as a critical
resource for immune responses to CSFV, and CSFV infection
is demonstrated to strongly afect the function of PBMCs (14).
Terefore, after challenge of CSFV, changes of porcine IL-1,
IL-2, IL-4 and IL-8 expression were observed in this study.
Infammation is a protective response of the body to
ensure the removal of detrimental stimuli. Moderate in-
fammatory responses are favorable for the repair of the
damaged tissues, and also critical for the pathogenesis of
diseases (15). Te infammatory response is orchestrated by
proinfammatory cytokines such as TNF, IL-1, and IL-8.
Tese cytokines are pleiotropic proteins that regulate the
cell death of infammatory tissues, modify vascular endo-
thelial permeability, recruit blood cells to infamed tissues,
and induce the production of acute-phase proteins (16).
Infammatory cytokine IL-1β is essential in antiviral host
defences. Despite its essential role in host defense, high lev-
els of IL-1β are also responsible for side-efects like fever,
hypotension, vasodilatation or acute lung injury by fuid
accumulation in response to viral infection (17). IL-8, for-
merly known as neutrophil-activating peptide-1 (NAP-1),
is important in the initiation and development of infam-
matory processes through its capacity to attract and acti-
vate neutrophils (18). Te previous studies suggested that
CSFV infection had a more pronounced efect on cytokine
secretion of macrophages or PBMCs. An increase in mRNA
levels of IL-1β (19) and IL-6 (20) was observed in CSFV-
infected macrophages (21). Additionally, IFN-α, IL-8 and
TNF-α levels were involved in the immune responses dur-
ing CSFV infection with strains of diferent virulence (22).
IL-2 is a potent T-cell growth factor that induces lym-
phokine-activated killer activity, mediates activation-induced
cell death and is an essential factor for the development of
regulatory T-cells (23). IL-4 is produced by T helper (T)
2 cells. IL-4 is a pleiotropic cytokine and plays a number of
important roles, including the regulation of infammation
(24), acting as an autocrine growth factor to promote the
diferentiation of naive T cells to T2 cells and inhibiting
the diferentiation of naive T cells to T1 cells as well as
inhibiting cytokine production by T1 cells (25).
Recent studies demonstrated that CSFV could replicate
in all lymph nodes (21) and mouse bone marrow-derived im-
mature dendritic cells (BM-imDCs) efectively and were found
to promote the proliferation of allogeneic naive T cells, and
Figure 6: Te kinetics of IL-8 mRNA in PBMCs of pigs. Analyses of peripheral blood cell cytokine responses by stimulation
of CSFV isolate. PBMC were isolated and cytokine IL-6 expression was analyzed using RT-PCR. Results are expressed as
the mean data for each group of pigs and error bars represent standard deviation.
Research Articles
DECEMBER Book.indb 226 04/12/2014 10:57:16
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 227 CSFV Changes Interleukin Expression
induce a stronger T1 response (26). After pigs inoculated
with the Alfort 187 CSFV isolate, quantitative changes in the
T-lymphocyte population such as CD3(+), CD4(+) and CD8(+)
and cytokines IL-2, IL-4 and IFN-γ secreted by these cells in
serum, thymus and spleen were observed (27). As indicated in
the results of this study, the production of IL-1β, IL-2, IL-4
and IL-8 was signifcantly increased after infection with CSFV
in pigs, which suggested a possible mechanism for this virus to
evade the host’s immune and cause a persistent infection in pigs.
In summary, our observations provide new evidences that
an immune response is activated at the early stage of CSFV
infection with upregulated production of interleukins IL-1β,
IL-2, IL-4 and IL-8. Te increased expression of these cyto-
kines may in consort be the underlying cause of the observed
clinical symptoms in pigs infected with CSFV. Defning the
relationships between ILs expression and the pathology and
clinical manifestations of atypical CSF may help to shed light
on the molecular pathogenesis of atypical CSF infections.
ACKNOWLEDGEMENTS
Tis work was supported by grants from State Key Laboratory of
Veterinary Biotechnology (SKLVBF201203).
REFERENCES
1. Ruggli, N., Summerfeld, A., Fiebach, A. R., Guzylack-Piriou, L.,
Bauhofer, O., Lamm, C. G., Waltersperger, S., Matsuno, K., Liu, L.,
Gerber, M., Choi, K. H., Hofmann, M. A., Sakoda, Y. and Tratschin,
J. D.: Classical swine fever virus can remain virulent after specifc
elimination of the interferon regulatory factor 3-degrading function
of Npro. J. Virol. 83, 817-829, 2009.
2. Ruggli, N., Bird, B. H., Liu, L., Bauhofer, O., Tratschin, J. D. and
Hofmann, M. A.: N(pro) of classical swine fever virus is an antago-
nist of double-stranded RNA-mediated apoptosis and IFN-alpha/
beta induction. Virol. 340, 265-276, 2005.
3. Sato, M., Mikami, O., Kobayashi, M. and Nakajima, Y.: Apoptosis in
the lymphatic organs of piglets inoculated with classical swine fever
virus. Vet. Microbiol. 75, 1-9, 2000.
4. Jamin, A., Gorin, S., Cariolet, R., Le Potier, M. F. and Kuntz-Simon,
G.: Classical swine fever virus induces activation of plasmacytoid and
conventional dendritic cells in tonsil, blood, and spleen of infected
pigs. Vet. Res. 39, 7, 2008.
5. Rossi, S., Artois, M., Pontier, D., Cruciere, C., Hars, J., Barrat, J., Pa-
cholek, X. and Fromont, E.: Long-term monitoring of classical swine
fever in wild boar (Sus scrofa sp.) using serological data. Vet. Res. 36,
27-42, 2005.
6. Parchariyanon, S., Inui, K., Pinyochon, W., Damrongwatanapokin, S.
and Takahashi, E.: Genetic grouping of classical swine fever virus by
restriction fragment length polymorphism of the E2 gene. J. Virol.
Methods. 87, 145-149, 2000.
7. Plateau, E., Vannier, P. and Tillon, J. P.: Atypical hog cholera infec-
tion: viral isolation and clinical study of in utero transmission. Am. J.
Vet. Res. 41, 2012-2015, 1980.
8. Knoetig, S. M., Summerfeld, A., Spagnuolo-Weaver, M. and Mc-
Cullough, K. C.: Immunopathogenesis of classical swine fever: role
of monocytic cells. Immunology. 97, 359-366, 1999.
9. Zhao, J. J., Cheng, D., Li, N., Sun, Y., Shi, Z., Zhu, Q. H., Tu, C.,
Tong, G. Z. and Qiu, H. J.: Evaluation of a multiplex real-time RT-
PCR for quantitative and diferential detection of wild-type virus-
es and C-strain vaccine of classical swine fever virus. Vet. Microbi-
ol. 126, 1-10, 2008.
10. van Oirschot, J. T.: Vaccinology of classical swine fever: from lab to
feld. Vet. Microbiol. 96, 367-384, 2003.
11. Moennig, V.: Introduction to classical swine fever: virus, disease and
control policy. Vet. Microbiol. 73, 93-102, 2000.
12. Li, X., Xu, Z., He, Y., Yao, Q., Zhang, K., Jin, M., Chen, H. and Qian,
P.: Genome comparison of a novel classical swine fever virus isolated in
China in 2004 with other CSFV strains. Virus. Genes. 33, 133-142, 2006.
13. Summerfeld, A., Knotig, S. M. and McCullough, K. C.: Lymphocyte
apoptosis during classical swine fever: implication of activation-in-
duced cell death. J. Virol. 72, 1853-1861, 1998.
14. Li, J., Yu, Y. J., Feng, L., Cai, X. B., Tang, H. B., Sun, S. K., Zhang, H.
Y., Liang, J. J. and Luo, T. R.: Global transcriptional profles in pe-
ripheral blood mononuclear cell during classical swine fever virus in-
fection. Virus. Res. 148, 60-70, 2010.
15. Medzhitov, R.: Origin and physiological roles of infammation. Na-
ture. 454, 428-435, 2008.
16. Takeuchi, O. and Akira, S.: Pattern recognition receptors and infam-
mation. Cell. 140, 805-820, 2010.
17. Martinon, F., Mayor, A. and Tschopp, J.: Te infammasomes: guard-
ians of the body. Annu. Rev. Immunol. 27, 229-265, 2009.
18. Baggiolini, M., Imboden, P. and Detmers, P.: Neutrophil activation
and the efects of interleukin-8/neutrophil-activating peptide 1 (IL-
8/NAP-1). Cytokines. 4, 1-17, 1992.
19. Zafuto, K. M., Piccone, M. E., Burrage, T. G., Balinsky, C. A., Risat-
ti, G. R., Borca, M. V., Holinka, L. G., Rock, D. L. and Afonso, C. L.:
Classical swine fever virus inhibits nitric oxide production in infected
macrophages. J. Gen. Virol. 88, 3007-3012, 2007.
20. Fernandez-Sainz, I., Gladue, D. P., Holinka, L. G., O’Donnell, V.,
Gudmundsdottir, I., Prarat, M. V., Patch, J. R., Golde, W. T., Lu, Z.,
Zhu, J., Carrillo, C., Risatti, G. R. and Borca, M. V.: Mutations in
classical swine fever virus NS4B afect virulence in swine. J. Virol.
84, 1536-1549, 2010.
21. Choi, C., Hwang, K. K. and Chae, C.: Classical swine fever virus in-
duces tumor necrosis factor-alpha and lymphocyte apoptosis. Arch.
Virol. 149, 875-889, 2004.
22. von Rosen, T., Lohse, L., Nielsen, J. and Uttenthal, A.: Classical swine
fever virus infection modulates serum levels of INF-alpha, IL-8 and
TNF-alpha in 6-month-old pigs. Res. Vet. Sci. 95, 1262-1267, 2013.
23. Kim, H. P., Imbert, J. and Leonard, W. J.: Both integrated and difer-
ential regulation of components of the IL-2/IL-2 receptor system.
Cytokine. Growth. Factor. Rev. 17, 349-366, 2006.
24. Brown, M. A. and Hural, J.: Functions of IL-4 and control of its ex-
pression. Crit. Rev. Immunol. 17, 1-32, 1997.
25. Fiorentino, D. F., Bond, M. W. and Mosmann, T. R.: Two types of
mouse T helper cell. IV. T2 clones secrete a factor that inhibits cy-
tokine production by T1 clones. J. Exp. Med. 170, 2081-2095, 1989.
26. Zheng, F. Y., Qiu, C. Q., Jia, H. J., Chen, G. H., Zeng, S., He, X. B.,
Fang, Y. X., Lin, G. Z. and Jing, Z. Z.: Infection of mouse bone mar-
row-derived immature dendritic cells with classical swine fever vi-
rus C-strain promotes cells maturation and lymphocyte prolifera-
tion. Res. Vet. Sci. 95, 1268-1270, 2013.
27. Sanchez-Cordon, P. J., Nunez, A., Salguero, F. J., Carrasco, L. and
Gomez-Villamandos, J. C.: Evolution of T lymphocytes and cy-
tokine expression in classical swine fever (CSF) virus infection. J.
Comp. Pathol. 132, 249-260, 2005.
Research Articles
DECEMBER Book.indb 227 04/12/2014 10:57:16