Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 197 Pathobiology of Infectious Laryngotracheitis Virus in Chickens
INTRODUCTION
Infectious Laryngotracheitis (ILT) caused by Gallid herpes-
virus-1 causes a severe respiratory tract infection of chicken,
which produces considerable economic losses due to mor-
tality of infected chicks, pullets and adult birds and/or de-
creased weight gain and egg production. Te virus spreads
horizontally by aerosol and the diseases is rapidly propagated
among the commercial layers being reared in intensive farms
of closer vicinity. Mild forms of infection, sometimes enzoot-
ic are characterized by mucoid tracheitis, sinusitis, unthrifti-
ness and low mortality. However, serious disease outbreaks
continue to occur periodically whenever ILT virus strains
can move from persistently infected focks to non-vaccinated
birds. Te incidence of ILT is on the rise in many parts of
the world, which may be due to the usage of modifed live
vaccines that could establish latent infections similar to wild
ILT virus strains (1).
Infectious laryngotracheitis virus can establish a carrier
state in recovered birds. In chickens, this is characterized by
periods of latency interspersed with episodes of intermit-
tent virus shedding detectable by tracheal swabbing of live
recovered birds. Virus shedding or re-excretion may occur
spontaneously, but certain factors such as stress, rehousing
and onset of laying have also been shown to induce virus
shedding from latent carrier birds (2).
Infection of susceptible chickens results in virus replica-
tion in the epithelium of larynx and trachea, and potentially
other mucus membranes such as conjunctiva, respiratory si-
nuses, air sacs and lungs (3).
Viral DNA replication occurs by a rolling circle mecha-
nism with the formation of concatemers which are cleaved
into monomeric units and packaged into preformed nu-
cleocapsids within the nucleus (1). In the nucleus, capsids
are formed and flled with viral DNA. Ten, the nucleo-
Tissue Tropism and Pathobiology of Infectious Laryngotracheitis
Virus in Natural Cases of Chickens
Sivaseelan, S.,
1
* Rajan, T.,
1
Malmarugan, S.,
2
Balasubramaniam, G.A.
1
and Madheswaran, R.
1
1
Department of Veterinary Pathology, Veterinary College and Research Institute, Namakkal – 637002, Tamil Nadu, India.
2
Department of Veterinary Microbiology, Veterinary College and Research Institute, Tirunelveli – 627001, Tamil Nadu, India.
*
Corresponding Author: Dr. S. Sivaseelan, M.V.Sc., Ph.D Associate Professor, Department of Veterinary Pathology, Veterinary College and Research
Institute, Namakkal – 637002. Tamil Nadu, India. Tel: +91 9442937227, Email: pathologysiva@yahoo.co.in
ABSTRACT
Tissue tropism of Infectious Laryngotracheitis (ILT) virus in naturally occurring cases of feld outbreaks of
ILT in chicken was evaluated. Symptoms manifested by afected birds and the gross lesions from postmortem
examination were recorded. Te virus tissue tropism and histopathological changes was evaluated in tissue
samples collected from respiratory sinuses, larynx, trachea (anterior one third, middle, and posterior one
third), bronchi, lungs, air sacs, liver, spleen, intestine, and conjunctiva. About 60 sets of these samples were
subjected to Polymerase Chain Reaction (PCR) to confrm the ILT virus. Te severity of microscopic tissue
damage caused by ILT virus in diferent tissue was assessed by hematoxylin-eosin staining technique. It
was concluded that ILT virus possesses greater afnity towards the middle portion of the trachea and
conjunctiva, and lesser afnity towards larynx and other portions of the trachea. Viral afnity was not
detected in other tissues tested.
Keywords: Infectious Laryngotracheitis; Tissue Tropism; Pathobiology; Chicken.
DECEMBER Book.indb 197 04/12/2014 10:57:08
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 Sivaseelan, S. 198
capsids are transported into the cytoplasm by subsequent
envelopment and de-envelopment at the inner and outer
leafets of the nuclear membrane. Te cytoplasmic capsids
associate with electron dense tegument and are then re-
enveloped by a second budding event in the trans-Golgi
region followed by release of mature particles by exocytosis
(4).
Diagnosis of ILT can be performed by DNA detection
and virus (5) isolation and identifcation of intranuclear in-
clusion bodies (6). Tis study has been conducted in chicken
to evaluate the organ/tissue preference of ILT virus based on
the pathobiology.
MATERIALS AND METHODS
Sample collection
A total of 60 poultry farms (population varied from 10,000
to 100,000 birds) with history and symptoms of ILT were
investigated. Necropsy was carried out on recently dead
chicken carcasses and ailing birds. Tissue samples includ-
ing respiratory sinuses, larynx, trachea (anterior one third,
middle, and posterior one third), bronchi, lungs, air sacs,
liver, spleen, intestine, and conjunctiva were collected dur-
ing necropsy.
Preparation of tissue homogenate
Individual tissue samples were fnely minced and 20% sus-
pension was preapred with phosphate bufer saline contain-
ing Penicillin (2000 IU / ml) and Streptomycin (2 mg / ml).
Te samples were kept at room temperature for 1 hour and
then centrifuged at 2000 rpm for 15 minutes. Te super-
natant was collected, fltered through Millipore membrane
flter, treated with antibiotics and stored at -10°C. Tis mate-
rial was used for egg inoculation.
Egg inoculation technique
About 0.2 mL of supernatant fuid was inoculated onto
the dropped chorioallantoic membrane (CAM) of 10 to
12 days old embryonated chicken eggs. Te eggs were in-
cubated at 37°C for 4-6 days. Te CAMs were harvested
and examined for the formation of pock lesions (7). Te
CAM with pock lesions were utilized for histopathological
examination and the presence of ILTV was confrmed by
PCR technique.
Polymerase Chain Reaction
DNA was extracted by a phenol:chloroform:isoamyl alco-
hol method (7) and PCR was conducted in a thermal cycler
(Eppendorf) as per the procedure of Villarreal et al. (8).
Te following forward and reverse primers were used for the
amplifcation of target sequence of p32 gene of ILTV that
produced a 588-bp fragment.
Forward primer
5’ - CTACGTGCTGGGCTCTAATCC - 3’
Reverse primer
5’ – AAACTCTCGGGTGGCTACTGC - 3’
Te reaction was carried out in a Eppendorf thermo-
cycler, with a initial denaturation at 95°C for 5 minutes,
followed by 35 cycles at 95°C for 1min, 55°C for 1.5 min,
72°C for 2 min, and a fnal extension at 72°C for 10min. Ten
microliters of the PCR product were analyzed by electro-
phoresis in 2 per cent agarose gel, stained with 0.5 mg/mL
ethidium bromide and observed under UV light for visual-
ization of the 588-bp fragment.
Pathobiology – gross lesions and histopathology
Detailed necropsy was conducted on randomly selected birds
and the gross lesions were recorded. A transverse section of
tissue approximately 0.5 cm in thickness was taken from the
selected organs. Te CAMs with pock lesions were preserved
as such. Tissue pieces were fxed in 10 percent bufered neu-
tral formalin and trimmed to a thickness of about 3 mm. Te
tissues were dehydrated, cleared and embedded in parafn
in a routine manual processing. Tissues for histopathological
examinations were cut at 3 to 5 µm thicknesses, mounted on
glass slides and subjected to Haematoxylin-Eosin (H&E)
staining technique, Phloxine-Tartrazine staining technique,
and Gordon and Sweet’s method for reticulin staining tech-
nique for (9).
Cytology
Scraping of an intact sheet of epithelium, including as little
blood and exudate as possible, from afected trachea was
taken with a round blade scalpel. Te scraping was deposited
near the mid-point of a clean, oil free slide. With a second
clean slide, the tissue was pressed onto the frst slide with a
gentle rotary pressure until it was fattened out in a thin layer.
Te two slides were drawn apart parallel to one another. Te
smears were stained with haematoxylin and eosin.
Research Articles
DECEMBER Book.indb 198 04/12/2014 10:57:08
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 199 Pathobiology of Infectious Laryngotracheitis Virus in Chickens
RESULTS
Clinical sigs and gross pathological fndings
Te chickens afected with ILT showed nasal discharge and
moist rales followed by coughing, gasping, sneezing, de-
pression, labored breathing, expectoration of blood-stained
mucus and pump hand respiration (Figure 1). Respiratory
sound was audible from few afected birds. Afected birds
showed conjunctivitis, swelling of the infraorbital sinuses and
closed eyes. In severe cases, eyelids were adhered with dry,
crusty, ocular discharge which stuck to the eyelids and skin
around the eye. Some birds coughed up bloody mucus, which
was found on and around the beak and in the oral cavity. In
severely afected fock, spots of dried bloody exudates were
found on the sides and bottom of cages. In some farms, dried
blood spots were noticed on the wall of feeder and at water-
ing points. Laying birds showed depression, anorexia and
decreased egg production. In broilers, young chicks stretched
out their neck due to dyspnea. Mortality rate progressively
increased daily and within 3 to 5 days about 30 to 40 per
cent of the fock died.
At post portem the laryngeal and tracheal mucosa showed
discrete congestion and generalized catarrhal changes in the
less severe form of the disease. Te lumen contained whitish
or yellowish exudate partially occluding the lumen. In severe
form, the mucosa revealed hemorrhagic lesions varying from
discrete to difuse foci (Figure 2). Tiny blood clots were ob-
served sticking on to the laryngeal and tracheal mucosa in
some cases.
Occlusion of tracheal and laryngeal lumen by whitish
or yellowish or reddish plaques were observed in severely
afected cases. Pneumonic changes of congestion, consolida-
tion and red hepatisation were noticed in both the lungs of
the severely afected birds.
Histopathology and tissue tropism
In the ILT afected focks, histopathological evaluation of
respiratory organs was carried out sequentially from birds
afected with manifestations of respiratory distress.
Mid-portions of trachea of chickens in the earlier stages
of the disease showed congestion of mucosal and submuco-
sal blood vessels, followed by discontinuation of the intact
mucosa, deciliation and appearance of eosinophilic intra-
nuclear inclusions in the surface epithelial cells. Formation
of multinucleated giant cells (syncytia) with the presence
of intranuclear inclusions was observed in the next stage. It
was followed by appearance of heterophils in the mucosal
areas of the trachea in addition to the presence of inclusions.
Disassociation of tracheal epithelium and infltration of lym-
phocytes were observed subsequently. Te size of the inclu-
sions was increased and almost all epithelial cells of trachea
showed inclusion bodies under Phloxine-Tartrazine staining
technique in the following stage (Figure 3). Distruption of
blood vessel walls with escape of RBCs was noticed in se-
verely afected birds.
Gordon and Sweet’s method for reticulin staining tech-
nique revealed the rupture of reticulin fbres, disassociation
of cells and disruption of blood vessels in the tracheal epithe-
Figure 1: ILT afected bird; pump hand like respiration with wide
open beak.
Figure 2: Trachea from ILT afected chicken; haemorrhagic lesion.
Research Articles
DECEMBER Book.indb 199 04/12/2014 10:57:08
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 Sivaseelan, S. 200
lium leading to the haemorrhagic tracheitis (Figure 4). After
this stage, the disrupted and necrosed epithelial cells started
sloughing and some of these cells also contained the intra-
nuclear inclusion bodies. Cytological examination of scrap-
ing from middle portion of trachea showed the intranuclear
inclusion bodies. Middle potions of trahcea showed inclusion
bodies in 30 farms. In 12 farms (Farm No. 30 - 41), in ad-
dition to the middle portion of trachea even the larynx and
anterior potion of the trachea also revealed inclusion bodies.
Conjunctiva showed severe congestion and infltration
of infammatory cells in between and under the epithelium.
Eosinophilic intranuclear inclusion bodies were observed in
several epithelial cells under Phloxine -Tartrazine staining
technique in 30 farms in which the middle portion of the
trachea also revealed inclusion bodies.
Microscopic observation of lesions from the larynx and
other portions of trachea revealed degenerative changes of
epithelium, vascular congestion and sporadic development
of intranuclear inclusion bodies even in the severely afected
birds.
Tissue samples of respiratory sinus, bronchi, air sacs, liver,
spleen and intestine did not reveal either any characteristic
microscopic lesions or inclusion bodies.
In severely afected cases, the lung showed hemorrhages
and infltration of heterophils, mononuclear cells and plasma
cells into the interalveolar spaces. Blood vessel congestion
Figure 5: Chorioallantoic membrane; chicken embryo, opaque plaques
induced by ILTV.
Figure 3: Trachea from ILT afected chicken; epithelial cells with
eosinophilic intranuclear inclusion bodies. Phloxine-Tartrazine; 1500x.
Figure 4: Trachea from ILT afected chicken; disruption of blood
vessel by rupture of reticulin fbres. Silver nitrate-Gold chloride; 1000x.
Figure 6: 588 bp PCR product on agarose gel electrophoresis.
Research Articles
DECEMBER Book.indb 200 04/12/2014 10:57:10
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 201 Pathobiology of Infectious Laryngotracheitis Virus in Chickens
was noted. Acute alveolar emphysema was observed in some
birds. Mild edema was observed within the air spaces. Some
birds also revealed hemorrhage in the intra- and inter- al-
veolar spaces and terminal bronchioles.
Diagnosis
Te inoculation of diferent portions of trachea, larynx
and conjunctiva from 42 farms out of 60 suspected for ILT
caused the formation of opaque plaques on the CAM (Figure
5) resulting from necrosis and proliferative tissue reactions
induced by the ILTV. Plaques were observed as early as 2
days post inoculation and embryo deaths occurred 2-8 days
later. All the 42 isolates produced band at 588-bp by PCR
(Figure 6). All these PCR results coincided with the inclu-
sion body observation in diferent tissue samples.
Farm details, number of samples per farm, tissue samples
details, PCR result and inclusion body observation are sum-
marized in the table. Tissue samples of respiratory sinus,
bronchi, lung, air sacs, liver, spleen and intestine from the
same birds were negative by PCR.
DISCUSSION
In embryonated chicken eggs, ILT virus causes formation of
opaque plaques on the CAM which serves as a preliminary
screening for ILTV (7). Observation of opaque plague on the
CAM and formation of a band at 588 bp by PCR confrmed
the ILTV in diferent portions of trachea, larynx and con-
junctiva. Tissue samples of respiratory sinus, bronchi, lung,
air sacs, liver, spleen and intestine from the same birds proved
negative by PCR indicating ILT virus does not replicate in
these tissues.
Conjunctivitis, swelling of the infraorbital sinuses and
closed eyes noticed in this study correlated well with the
earlier report of Guy and Bagust (10). Tese lesions probably
were induced by the proliferation of ILTV in conjunctiva,
which has been supported by the detection of ILTV in con-
junctiva by PCR technique and demonstration of inclusion
bodies by histopathology. Te gross and histopathological
lesions observed in this study correlated well with the earlier
reports of Hidalgo (1) and Tahseen (11).
Sloughing of tracheal epithelial cells and release of RBCs
and infammatory cells due to the rupture of blood vessels
might be the reason for the formation of plaques noticed
grossly. Plaques formed by the mixture of blood, desqua-
mated epithelial cells, and exudate and fbrin from trachea
have caused total occlusion of trachea, especially at larynx re-
gion causing sufocation and death of severely afected birds.
Partial occlusion of airways was probably the reason for the
emphysema in less severe cases. Pneumonic changes observed
in the lung might be due to the extension of infammation
to the bronchi (11), which is also supported by negativity for
ILTV by PCR. Eye and conjunctival lesions may have been
caused by the proliferation of ILTV in these regions.
Guy et al. (12) reported that diagnosis of ILT could be
based on the demonstration of the inclusion bodies in tis-
sues but his experience infers that its sensitivity is poor and
Table 1: Farm wise PCR Result and Inclusion body observation of ILT in natural cases chicken
Farm Numbers
1-12 13 14-26 27-29 30-41 42-46 47-57 58-60 1-12 13 14-26 27-29 30-41 42-46 47-57 58-60
Organs tested PCR Result Inclusion body
Sinus - - - - - - - - - - - - - - - -
Larynx - - - - + - - - - - - - + - - -
Trachea Anterior - - - - + - - - - - - - + - - -
Middle + - + - + - + - + - + - + - + -
Posterior - - - - - - - - - - - - - - - -
Bronchi - - - - - - - - - - - - - - - -
Lung - - - - - - - - - - - - - - - -
Airsac - - - - - - - - - - - - - - - -
Liver - - - - - - - - - - - - - - - -
Spleen - - - - - - - - - - - - - - - -
Intestine - - - - - - - - - - - - - - - -
Conjunctiva + - + - + - + - + - + - + - + -
- Negative; + Positive (Sample size: Five to ten sets of samples per farm)
Research Articles
DECEMBER Book.indb 201 04/12/2014 10:57:10
Israel Journal of Veterinary Medicine  Vol. 69 (4)  December 2014 Sivaseelan, S. 202
also requires pathological expertise In this study, detection of
inclusion body of ILTV was considered as a evaluation tool
to assess the tissue preference based on the level of inclusion
bodies formed and the degree of damage induced by the
virus. Tough, PCR could only designate either positivity of
negativity of the sample tested. Poor sensitivity to detect in-
clusion bodies by the routine H&E technique was improved
by the utilization of Phloxine – Tartrazine technique, which
yielded better appreciation of ILTV intranuclear inclusions.
Demonstration of inclusion bodies in middle portion
of trachea and conjunctiva indicates the greater afnity of
ILT virus towards these tissues. Sporadic development of
intranuclear inclusion bodies in larynx and other portions of
trachea even in the severely afected birds reveal lesser afnity
to these tissues. Inclusion bodies could not be detected in
tissue samples of respiratory sinuses, bronchi, air sacs, liver,
spleen and intestine indicates that ILT virus has no afnity
to these tissues.
Based on the PCR results and histopathological evidenc-
es, it is concluded that ILT virus has greater afnity towards
the middle portion of the trachea and conjunctiva, lesser af-
fnity towards larynx and other portions of the trachea and
no afnity to all other tissues. Tese fndings are supported
by the recent report of Wang et al. (13).
REFERENCES
1. Hidalgo, H.: Infectious Laryngotracheitis: A Review. Brazilian J
Poult Sci. 5: 157-168, 2003.
2. Hughes, C.S., Gaskell, R.M., Jones, R.C., Bradbury, J.M. and
Jordan, F.T.W.: Efects of certain stress factors on the re-excre-
tion of infectious laryngotracheitis virus from latently infected
carrier birds. Res. Vet. Sci. 46: 274-276, 1989.
3. Bagust, T.J., Calnek, B.W. and Fahey, K.J.: Gallid-1 herpesvirus
infection in the chicken. 3. Reinvestigation of the pathogenesis of
infectious laryngotracheitis in acute and early post-acute respira-
tory disease. Avian Dis. 30: 179-190, 1986.
4. Fuchs, W., Veits, J., Helferich, D., Granzow, H.,Teifke, J.P. and
Mettenleiter, T.C.: Molecular biology of avian infectious laryn-
gotracheitis virus. Vet. Res. 38: 261-279, 2007.
5. Chia Ou, S. and Giambrone, J.J.: Infectious laryngotracheitis vi-
rus in chickens. World J. Virol. 1:142-149, 2012.
6. Crespo, R., Woolcock, P.R., Chin, R.P., Shivaprasad, H.L. and
Garcia,M.: Comparison of diagnostics techniques in an outbreak
of infectious aryngotracheitis from meat chickens. Avian Dis. 51:
858-862, 2007.
7. Ebrahimi, M.M., Pourbakhsh, S.A., Shahsavandi, S., Momayez,
R. and Gholami M.R.: Isolation and identifcation of infectious
laryngotracheitis virus from commercial focks of Iran using vari-
ous techniques. Arch. Razi. Ins. 56: 11-22, 2003.
8. Villarreal, L.Y.B., Brandao, P.E.B., Chacón, J.L.V., Doretto, J.L.,
Ito, N., Gama, N.S., Ishizuka, M.M., Luchese, A., Buchala, F.,
Ferreira , A.C.S. and Ferreira, A.J.P.: Detection and molecular
characterization of infectious laryngotracheitis virus in laying
hens in Brazil. Brazilian J. Poult. Sci. 6: 253 – 256, 2004.
9. Bancroft, J.D. and Gamble, M.: Teory and practice of histo-
logical techniques. 6
th
ed, 2008, Churchill Livingstone, London;
2008.
10. Guy, J.S. and Bagust, T.J.: Laryngotracheitis. In: Saif, Y.M.,
Barnes, H.J., Glisson, J.R., Fadly, A.M., McDougald, L.R. and
Swayne, D.E. ed. Diseases of poultry. 11
th
ed, 2003, Ames (IA):
Iowa State University Press, pp 121-134.
11. Tahseen, A. Infectious laryngotracheitis (ILT) targets broilers.
World Poult. 25: 28-30, 2010.
12. Guy, J.S., Barnes, H.J. and Smith, L.G.: Rapid diagnosis of infec-
tious laryngotracheitis using a monoclonal antibody-based im-
munoperoxidase procedure. Avian Pathol. 21: 77-86, 1992.
13. Wang, L.G., Ma, J., Xue, C.Y., Wang, W., Guo, C., Chen, F., Qin,
J.P., Huang, N.H., Bi, Y.Z. and Cao, Y.C.: Dynamic distribution
and tissue tropism of infectious laryngotracheitis virus in experi-
mentally infected chicken. Arch. Virol. 158:659-666, 2013.
Research Articles
DECEMBER Book.indb 202 04/12/2014 10:57:10